mesh generating software scanfe Search Results


93
Addgene inc tgbac gad1b gal4vp16
Tgbac Gad1b Gal4vp16, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mesh+generating+software+scanfe/pVSV+Venus+VSV-G+(Plasmid+%2336399)/pm38484735-298-168-185
Average 93 stars, based on 1 article reviews
tgbac gad1b gal4vp16 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

94
Santa Cruz Biotechnology non incubated lc3c blots
Intracellular P. gingivalis ( P. g ) Significantly Induces and Co-Localizes with <t>LC3C,</t> an Isomer of LC3, and this Specific Event is Highly Dependent on HSp27 for Successful Autophagic Survival. Human primary GECs were treated with HSp27 siRNA (100nM) for 48 h. P. g was added at MOI 100 to GECs, which were incubated for 6 or 24 h. ( A ) GECs were targeted for P. g (rabbit anti- P. g ; goat anti-rabbit Ultra Small Gold Antibody) and labeled P. g was found to be readily ensconced within double-membraned autophagosomes in GECs. Following HSp27 depletion, P. g appeared to readily start to degrade. Representative transmission electron microscopy images of P. g -infected GECs were also taken at 80 kV and 100000x magnification. Scale bar is 800 nm. ( B ) 6 h and 24h P. g-infected GECs were also stained for P. g (rabbit anti-P . g ; Alexa 488; green) and LC3C (mouse anti-LC3C; Alexa 568; red) to examine whether LC3C characterizes P. g -specific autophagosomes. These cells were then imaged via confocal microscopy (Leica DM6 CS Stellaris 5 Confocal/Multiphoton System) at 63x. The range of z-stacks was kept consistent and representative images were selected from the mid-ranged sections. ( Bi ) The Imaris software was utilized to obtain a xoomed 63x Orthogonal Image of 24 h P. g infection and found heightened co-localization between P. g and LC3C. LC3C was found to readily colocalize with P. g, having an average Pearson correlation coefficient of 0.96 via the Imaris post-processing software. ( C ) Lysates of infected and HSp27-depleted GECs were also analyzed via western blotting. Non-target controls were performed and not shown. (Ci) Quantitative ImageJ analysis was performed for the western blot results. Data is represented as Mean±SD, where n=3 and p<0.05 was considered as statistically significant via Student two-tailed T-test. **p<.005.
Non Incubated Lc3c Blots, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mesh+generating+software+scanfe/HSP+27+Antibody/bio_rxiv__2024__07__01__601539-269-7-14
Average 94 stars, based on 1 article reviews
non incubated lc3c blots - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

90
Sino Biological a wsn 33 ha1
RNAi screening identifies RABGAP1L as an IAV restriction factor (A) Schematic representation of recombinant IAV <t>WSN/33</t> in which the coding region for the hemagglutinin (HA) glycoprotein has been replaced by Renilla luciferase (WSN/33- Renilla ). (B) RNAi-screening experimental workflow. (C) MRC-5-HA cells were transfected for 30 h with individual siRNAs targeting MX1 or IFITM3 or with a non-targeting (NT) control siRNA. Following stimulation with IFNα2 (1,000 U/mL or mock) for 16 h, cells were infected with WSN/33- Renilla (MOI 5 PFU/cell) in the presence of the live-cell substrate EnduRen. Luciferase activity was monitored up to 12 h post-infection (p.i.), and the area under the curve (AUC) was calculated as indicated. Mean values from 50 technical replicates across two independent biological experiments are plotted, with error bars representing SDs. (D) Hit criteria for RNAi screening. In a primary screen following the workflow in (B), 100 putative ISGs were silenced with four individual siRNAs each. Twenty-two genes met the threshold, and 20 were re-tested in a confirmation screen. Applying the same hit criteria, a total of 8 putative ISGs were confirmed in both screening rounds. (E) Heatmap showing Z scores of positive controls ( MX1 and IFITM3 ) and the top 8 hits from the two RNAi-screening rounds. Columns represent individual siRNAs targeting genes listed in rows. See also .
A Wsn 33 Ha1, supplied by Sino Biological, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mesh+generating+software+scanfe/Influenza+A+H1N1+(A%2FWSN%2F1933)+Hemagglutinin+%2F+HA1+Antibody%2C+Rabbit+PAb%2C+Antigen+Affinity+Purified/pmc08939003-461-116-122
Average 90 stars, based on 1 article reviews
a wsn 33 ha1 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

95
Jackson Immuno donkey anti mouse biotin sp

Donkey Anti Mouse Biotin Sp, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mesh+generating+software+scanfe/Biotin-SP+(long+spacer)+AffiniPure+Donkey+Anti-Mouse+IgG/pmc10873109-16-0-4
Average 95 stars, based on 1 article reviews
donkey anti mouse biotin sp - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

99
LI-COR image studio lite version 5 2 software

Image Studio Lite Version 5 2 Software, supplied by LI-COR, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mesh+generating+software+scanfe/Fc+IMAGE+STUDIO+SW+5+USER/10__1128_slash_mbio__01554___16-221-27-33
Average 99 stars, based on 1 article reviews
image studio lite version 5 2 software - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
Nikon z stacks

Z Stacks, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mesh+generating+software+scanfe/NIS-Elements/pmc04507007-244-14-27
Average 99 stars, based on 1 article reviews
z stacks - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
Yokogawa Electric spinning disk confocal scan system
Early disuse persists synaptic expression of GluA2-lacking AMPARs as changes in synapse numbers on ventral horn neurons and dendritic neuropils after spinal cord injury Overdrive of glutamate AMPARs is known to reflect maladaptive spinal cord plasticity in central nervous <t>system</t> trauma. , (A–E) Workflow diagram of the automated and unbiased high-resolution robotic <t>confocal</t> microscopy. To assess synaptic levels of glutamate AMPARs on dendritic fields and somata of large ventral horn neurons, the randomized microscopic detection and analysis were performed blindly by <t>spinning</t> <t>disk</t> confocal <t>scan</t> system at week 8 post-injury according to the established algorithm. , (A) Fluorescently labeled large ventral horn neurons (diameter >40 μm) indicated presumptive motorneurons and were detected centrally in the sampling window (80 × 80 μm) at 63× magnification. (B) A stack of high-resolution images was taken in the z-plane through a 650 nm filter for presynaptic synaptophysin (upper panel) and a 490 nm filter for postsynaptic AMPARs (lower panel) at each level separately (scale bar: 20 μm). (C) Scanned confocal z stacks were deblurred by 3-D blind iterative deconvolution, and then the total expression of synaptic colocalized AMPAR puncta was quantified using the established approach. (D) Single optical planes showing maximal synaptic colocalization of presynaptic synaptophysin and postsynaptic AMPARs on the somata were selected among the z stacks, and then the optical fraction images of the somatic membrane were generated to assess the synaptic AMPAR expression on the plasma membrane (left panel). Representative optical detection of the presynaptic vesicle, postsynaptic AMPAR subunit, and synaptic colocalization (white arrows) are shown in the enlarged image of the boxed region from the plasma membrane image (right panel; see <xref ref-type=Figure 5 ). (E) Schematic overview on synaptic colocalization of AMPAR subunits GluA1 and GluA2. The overlapping of presynaptic synaptophysin (magenta) and synaptic AMPAR subunit (GluA1 or GluA2; green) puncta indicates synaptic colocalization (white). (F) Representative merged 3-D confocal image of large ventral horn neurons showed postsynaptic GluA1 (green) and synaptophysin (magenta) positive presynaptic terminals on the soma with surrounding dendritic neuropils in the control subject (left panel). The enlarged image of the boxed region from (F, left panel) demonstrates relatively few synaptic colocalized GluA1 puncta (lower right panel, white) within the merge image (upper right panel) in the control subject. (G) Representative merged motorneuron from the early disuse subject demonstrating greater numbers of membrane and dendritic GluA1 colocalized to the synapses (left panel). The enlargement of the boxed region from (G, left panel) demonstrates high levels of synaptic colocalized GluA1 puncta (lower right panel, white) within the merge image (upper right panel) in the early disuse subject. Representative images of synaptic GluA2 puncta are shown in Figure S8 . (H) Quantification of synaptic colocalized AMPAR expression with synaptophysin though the confocal z stacks in the early disuse group ( n = 5; total 164 cells, total 11,971 optical planes for GluA1; total 138 cells, total 9,788 planes for GluA2) compared to the control group ( n = 6; total 163 cells, total 13,037 images for GluA1; total 156 cells, total 10,894 optical planes for GluA2) on the somata and dendritic neuropil. Random effects ANOVA controlling for non-independence of within-subject and within-section variability confirmed that early disuse significantly increased in synaptic colocalization of GluA1 (effect of early disuse condition: F (1,9) = 8.05, ∗ p = 0.019) but no significant difference in synaptic colocalization of GluA2 (effect of early disuse condition: F (1,9) = 0.074, p = 0.792). There was a non-significantly difference between both groups in the presynaptic synaptophysin and postsynaptic AMPAR subunit ( Figure S8 ). Representative examples reflect the group median. ∗ p < 0.05 by one-way ANOVA. All data are shown as means ± SEM. Scale bars in the lower magnification images represent 20 μm, and the scale bar in the higher magnification image represents 5 μm. " width="250" height="auto" />
Spinning Disk Confocal Scan System, supplied by Yokogawa Electric, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mesh+generating+software+scanfe/CSU-X1/pmc11987634-405-50-56
Average 99 stars, based on 1 article reviews
spinning disk confocal scan system - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

90
Lumonics Inc scan array™ software
Early disuse persists synaptic expression of GluA2-lacking AMPARs as changes in synapse numbers on ventral horn neurons and dendritic neuropils after spinal cord injury Overdrive of glutamate AMPARs is known to reflect maladaptive spinal cord plasticity in central nervous <t>system</t> trauma. , (A–E) Workflow diagram of the automated and unbiased high-resolution robotic <t>confocal</t> microscopy. To assess synaptic levels of glutamate AMPARs on dendritic fields and somata of large ventral horn neurons, the randomized microscopic detection and analysis were performed blindly by <t>spinning</t> <t>disk</t> confocal <t>scan</t> system at week 8 post-injury according to the established algorithm. , (A) Fluorescently labeled large ventral horn neurons (diameter >40 μm) indicated presumptive motorneurons and were detected centrally in the sampling window (80 × 80 μm) at 63× magnification. (B) A stack of high-resolution images was taken in the z-plane through a 650 nm filter for presynaptic synaptophysin (upper panel) and a 490 nm filter for postsynaptic AMPARs (lower panel) at each level separately (scale bar: 20 μm). (C) Scanned confocal z stacks were deblurred by 3-D blind iterative deconvolution, and then the total expression of synaptic colocalized AMPAR puncta was quantified using the established approach. (D) Single optical planes showing maximal synaptic colocalization of presynaptic synaptophysin and postsynaptic AMPARs on the somata were selected among the z stacks, and then the optical fraction images of the somatic membrane were generated to assess the synaptic AMPAR expression on the plasma membrane (left panel). Representative optical detection of the presynaptic vesicle, postsynaptic AMPAR subunit, and synaptic colocalization (white arrows) are shown in the enlarged image of the boxed region from the plasma membrane image (right panel; see <xref ref-type=Figure 5 ). (E) Schematic overview on synaptic colocalization of AMPAR subunits GluA1 and GluA2. The overlapping of presynaptic synaptophysin (magenta) and synaptic AMPAR subunit (GluA1 or GluA2; green) puncta indicates synaptic colocalization (white). (F) Representative merged 3-D confocal image of large ventral horn neurons showed postsynaptic GluA1 (green) and synaptophysin (magenta) positive presynaptic terminals on the soma with surrounding dendritic neuropils in the control subject (left panel). The enlarged image of the boxed region from (F, left panel) demonstrates relatively few synaptic colocalized GluA1 puncta (lower right panel, white) within the merge image (upper right panel) in the control subject. (G) Representative merged motorneuron from the early disuse subject demonstrating greater numbers of membrane and dendritic GluA1 colocalized to the synapses (left panel). The enlargement of the boxed region from (G, left panel) demonstrates high levels of synaptic colocalized GluA1 puncta (lower right panel, white) within the merge image (upper right panel) in the early disuse subject. Representative images of synaptic GluA2 puncta are shown in Figure S8 . (H) Quantification of synaptic colocalized AMPAR expression with synaptophysin though the confocal z stacks in the early disuse group ( n = 5; total 164 cells, total 11,971 optical planes for GluA1; total 138 cells, total 9,788 planes for GluA2) compared to the control group ( n = 6; total 163 cells, total 13,037 images for GluA1; total 156 cells, total 10,894 optical planes for GluA2) on the somata and dendritic neuropil. Random effects ANOVA controlling for non-independence of within-subject and within-section variability confirmed that early disuse significantly increased in synaptic colocalization of GluA1 (effect of early disuse condition: F (1,9) = 8.05, ∗ p = 0.019) but no significant difference in synaptic colocalization of GluA2 (effect of early disuse condition: F (1,9) = 0.074, p = 0.792). There was a non-significantly difference between both groups in the presynaptic synaptophysin and postsynaptic AMPAR subunit ( Figure S8 ). Representative examples reflect the group median. ∗ p < 0.05 by one-way ANOVA. All data are shown as means ± SEM. Scale bars in the lower magnification images represent 20 μm, and the scale bar in the higher magnification image represents 5 μm. " width="250" height="auto" />
Scan Array™ Software, supplied by Lumonics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mesh+generating+software+scanfe/scan+array++software/10__3892_slash_ijo__31__6__1325-55-18-21
Average 90 stars, based on 1 article reviews
scan array™ software - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
OriGene meg3 sirna plasmids
Classification of <t>MEG3</t> -ON and MEG3 -OFF human embryonic stem cells (hESCs) by detecting the expression of the DLK1-DIO3 locus-derived non-coding RNAs (ncRNAs). (A) The DLK1-DIO3 imprinted locus, which is highly conserved between mice and humans, including clusters of maternally expressed functional ncRNAs, which are marked in red. The human homologs of the Gtl2 and Rian mice genes are MEG3 and MEG8 , respectively. Lollipops with closed circles represent methylated CpG regions, and open circles represent unmethylated CpG regions. Mat, maternal chromosome; Pat, paternal chromosome. (B) The hESCs with high expression levels of imprinted long non-coding RNAs (lncRNAs) ( MEG3 and MEG8 ) and of several imprinted microRNAs (miRNAs) from the DLK1-DIO3 locus (miR-127-3p, miR-154, miR-376c, miR-495, miR-494, and miR-496) were classified as MEG3 -ON hESCs. The hESCs without detectable MEG3 expression accompanied by significant repression of other ncRNAs from the same locus were classified as MEG3 -OFF hESCs. GAPDH was used as an internal control for mRNA expression analysis, and RNU48 was used as an internal control for miRNA expression analysis. The quantitation of lncRNA and miRNA expression was performed by using the 2 −ΔΔCp method. Error bars represent the standard error of the mean generated from three biological repeats. ** P <0.01 with respective MEG3 -ON groups by Student’s t test. DLK1-DIO3 , delta-like homolog 1 gene and the type III iodothyronine deiodinase gene; Gtl2 , gene trap locus 2; IG-DMR, intergenic differentially methylated region; MEG3 , maternally expressed gene 3; N.D., not detectable.
Meg3 Sirna Plasmids, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mesh+generating+software+scanfe/Meg3+Mouse+shRNA+Plasmid/pmc04417332-106-1-32
Average 90 stars, based on 1 article reviews
meg3 sirna plasmids - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

91
OriGene nckap1 shrna
<t>NCKAP1</t> is associated with impaired phagocytic function in ALS(R)-iMGs. Transcriptome analysis of iMGs generated from three ALS(R) and four ALS(S) patients. a Principal component analysis (PCA) of all expressed genes in individual ALS(R)-iMGs and ALS(S)-iMGs. b Venn diagram illustrating that the number and overlap of transcripts differed significantly in the two groups according to RNA-seq (1.5-fold-change). c Functional analysis using DAVID software from 2559 transcripts that were significantly altered in ALS(R)-iMGs compared to ALS(S)-iMGs (10 GO analyses). The number within each bar indicates the number of genes in the database for the specified term. d Volcano plot showing transcripts with significantly altered abundance in ALS(R)-iMGs compared to ALS(S)-iMGs. We tested for significant differences between ALS(R)-iMGs and ALS(S)-iMGs samples, which are highlighted, using a cutoff of P values of 0.05 with a 1.5-fold-change ratio cutoff. GO genes of phagocytosis (GO: 0,006,909) are presented. e A subset of 13 transcripts identified as “hits” (phagocytosis-related increased or decreased abundance) in ALS(R)-iMGs compared to ALS(S)-iMGs were validated by RT-qPCR. f NCKAP1 mRNA expression in individual-subject-derived monocytes or iMGs from the two groups. The symbols represent individual-subject-derived monocytes or iMGs (ALS(R): n = 5; ALS(S): n = 8, from available samples) g Correlation of the relative expression of NCKAP1 in iMGs with the rate of disease progression from the symptom onset time to the sampling time point for the generation of iMGs (∆FS, points/month). Values are means ± SEM. Comparisons were made against control (* P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, ns, not significant; unpaired t test or two-way ANOVA with post hoc Tukey’s tests)
Nckap1 Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mesh+generating+software+scanfe/NCKAP1+Human+shRNA+Lentiviral+Particle/pmc10293423-97-13-35
Average 91 stars, based on 1 article reviews
nckap1 shrna - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology flna shrna lentiviral particles
<t>FLNA</t> inhibits TFAP2A expression in both SaOS2 and HeLa cells. A and B , effect of FLNA silencing on TFAP2A mRNA expression was analyzed using the mRNA-Seq data obtained from SaOS2 cell lines expressing control <t>shRNA</t> or FLNA shRNA. TFAP2A mRNA reads from three biological replicates and the log 2 fold change are presented in A and B , respectively. Log 2 fold change was obtained by comparing the mean of TFAP2A mRNA reads from FLNA shRNA samples with that from Ctrl shRNA samples. C and D , effect of FLNA knockdown on TFAP2A expression in SaOS2 cells; RT-qPCR ( C ) and Western blot ( D ) were performed using SaOS2 cells stably expressing control shRNA or FLNA shRNA. E and F , effect of FLNA knockdown on TFAP2A expression in HeLa cells. RT-qPCR ( E ) and Western blot ( F ) were performed using HeLa cell lines stably expressing control shRNA or FLNA shRNA. G and H , effect of FLNA overexpression on TFAP2A expression in HeLa cells. A HeLa cell line stably expressing HA-FLNA and its control cell line (empty vector) were used to extract total RNA. TFAP2A mRNA expression was analyzed by RT-qPCR using the cDNA synthesized from the total RNA ( G ). TFAP2A protein expression was detected by Western blot using the total cell lysate of these cell lines and the antibodies against the factors as indicated ( H ). I , expression of TFAP2A in SaOS2, 293T, and HeLa cells was analyzed by Western blot. Each column in histograms represents the mean ± SD of three biological replicates. ∗ p < 0.05; ∗∗ p < 0.01. p values were obtained by Student’s t test. RT-qPCR, reverse transcription–quantitative polymerase chain reaction.
Flna Shrna Lentiviral Particles, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mesh+generating+software+scanfe/Filamin+1+shRNA+(h)+Lentiviral+Particles/pmc09999235-287-16-30
Average 93 stars, based on 1 article reviews
flna shrna lentiviral particles - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

95
Taconic Biosciences c57bl 6 lrrk2 g2019s taconic biosciences rrid imsr tac
<t>FLNA</t> inhibits TFAP2A expression in both SaOS2 and HeLa cells. A and B , effect of FLNA silencing on TFAP2A mRNA expression was analyzed using the mRNA-Seq data obtained from SaOS2 cell lines expressing control <t>shRNA</t> or FLNA shRNA. TFAP2A mRNA reads from three biological replicates and the log 2 fold change are presented in A and B , respectively. Log 2 fold change was obtained by comparing the mean of TFAP2A mRNA reads from FLNA shRNA samples with that from Ctrl shRNA samples. C and D , effect of FLNA knockdown on TFAP2A expression in SaOS2 cells; RT-qPCR ( C ) and Western blot ( D ) were performed using SaOS2 cells stably expressing control shRNA or FLNA shRNA. E and F , effect of FLNA knockdown on TFAP2A expression in HeLa cells. RT-qPCR ( E ) and Western blot ( F ) were performed using HeLa cell lines stably expressing control shRNA or FLNA shRNA. G and H , effect of FLNA overexpression on TFAP2A expression in HeLa cells. A HeLa cell line stably expressing HA-FLNA and its control cell line (empty vector) were used to extract total RNA. TFAP2A mRNA expression was analyzed by RT-qPCR using the cDNA synthesized from the total RNA ( G ). TFAP2A protein expression was detected by Western blot using the total cell lysate of these cell lines and the antibodies against the factors as indicated ( H ). I , expression of TFAP2A in SaOS2, 293T, and HeLa cells was analyzed by Western blot. Each column in histograms represents the mean ± SD of three biological replicates. ∗ p < 0.05; ∗∗ p < 0.01. p values were obtained by Student’s t test. RT-qPCR, reverse transcription–quantitative polymerase chain reaction.
C57bl 6 Lrrk2 G2019s Taconic Biosciences Rrid Imsr Tac, supplied by Taconic Biosciences, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mesh+generating+software+scanfe/Lrrk2/pm39059388-901-55-58
Average 95 stars, based on 1 article reviews
c57bl 6 lrrk2 g2019s taconic biosciences rrid imsr tac - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

Image Search Results


Intracellular P. gingivalis ( P. g ) Significantly Induces and Co-Localizes with LC3C, an Isomer of LC3, and this Specific Event is Highly Dependent on HSp27 for Successful Autophagic Survival. Human primary GECs were treated with HSp27 siRNA (100nM) for 48 h. P. g was added at MOI 100 to GECs, which were incubated for 6 or 24 h. ( A ) GECs were targeted for P. g (rabbit anti- P. g ; goat anti-rabbit Ultra Small Gold Antibody) and labeled P. g was found to be readily ensconced within double-membraned autophagosomes in GECs. Following HSp27 depletion, P. g appeared to readily start to degrade. Representative transmission electron microscopy images of P. g -infected GECs were also taken at 80 kV and 100000x magnification. Scale bar is 800 nm. ( B ) 6 h and 24h P. g-infected GECs were also stained for P. g (rabbit anti-P . g ; Alexa 488; green) and LC3C (mouse anti-LC3C; Alexa 568; red) to examine whether LC3C characterizes P. g -specific autophagosomes. These cells were then imaged via confocal microscopy (Leica DM6 CS Stellaris 5 Confocal/Multiphoton System) at 63x. The range of z-stacks was kept consistent and representative images were selected from the mid-ranged sections. ( Bi ) The Imaris software was utilized to obtain a xoomed 63x Orthogonal Image of 24 h P. g infection and found heightened co-localization between P. g and LC3C. LC3C was found to readily colocalize with P. g, having an average Pearson correlation coefficient of 0.96 via the Imaris post-processing software. ( C ) Lysates of infected and HSp27-depleted GECs were also analyzed via western blotting. Non-target controls were performed and not shown. (Ci) Quantitative ImageJ analysis was performed for the western blot results. Data is represented as Mean±SD, where n=3 and p<0.05 was considered as statistically significant via Student two-tailed T-test. **p<.005.

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: Intracellular P. gingivalis ( P. g ) Significantly Induces and Co-Localizes with LC3C, an Isomer of LC3, and this Specific Event is Highly Dependent on HSp27 for Successful Autophagic Survival. Human primary GECs were treated with HSp27 siRNA (100nM) for 48 h. P. g was added at MOI 100 to GECs, which were incubated for 6 or 24 h. ( A ) GECs were targeted for P. g (rabbit anti- P. g ; goat anti-rabbit Ultra Small Gold Antibody) and labeled P. g was found to be readily ensconced within double-membraned autophagosomes in GECs. Following HSp27 depletion, P. g appeared to readily start to degrade. Representative transmission electron microscopy images of P. g -infected GECs were also taken at 80 kV and 100000x magnification. Scale bar is 800 nm. ( B ) 6 h and 24h P. g-infected GECs were also stained for P. g (rabbit anti-P . g ; Alexa 488; green) and LC3C (mouse anti-LC3C; Alexa 568; red) to examine whether LC3C characterizes P. g -specific autophagosomes. These cells were then imaged via confocal microscopy (Leica DM6 CS Stellaris 5 Confocal/Multiphoton System) at 63x. The range of z-stacks was kept consistent and representative images were selected from the mid-ranged sections. ( Bi ) The Imaris software was utilized to obtain a xoomed 63x Orthogonal Image of 24 h P. g infection and found heightened co-localization between P. g and LC3C. LC3C was found to readily colocalize with P. g, having an average Pearson correlation coefficient of 0.96 via the Imaris post-processing software. ( C ) Lysates of infected and HSp27-depleted GECs were also analyzed via western blotting. Non-target controls were performed and not shown. (Ci) Quantitative ImageJ analysis was performed for the western blot results. Data is represented as Mean±SD, where n=3 and p<0.05 was considered as statistically significant via Student two-tailed T-test. **p<.005.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Incubation, Labeling, Transmission Assay, Electron Microscopy, Infection, Staining, Confocal Microscopy, Software, Western Blot, Two Tailed Test

The Autophagic Lifestyle of P. gingivalis (P. g) is Highly Characterized by Only the LC3C Isoform of LC3, Which is not Increased During Starvation-Induced Autophagy in GECs. (A ) The LC3 A/B lipidation results of the same assay provided in . (B ) GECs were separately treated with LC3B siRNA (100nM) for 48h. P. g was added at MOI 100 to GECs for 6 h. Intracellular P. g survival after LC3B siRNA depletion was determined using a standard antibiotic protection assay using P. g- specific 16S rRNA primers. ( C ) GECs were subjected to starvation conditions in HBSS for 24 h. GECs were then collected and fixed so that immunofluorescence could be performed. GECs were stained for LC3C (rabbit anti-LC3C;Alexa 568; red). GECs were then imaged via confocal microscopy (Super Resolution Zeiss Airyscan LSM 880) at 63x. Western blotting (Not Shown) was utilized to confirm the lack of induction of LC3C I and LC3C II. Data is represented as Mean±SD; n=3; p<0.05 is considered statistically significant (Student two-tailed T-test).

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: The Autophagic Lifestyle of P. gingivalis (P. g) is Highly Characterized by Only the LC3C Isoform of LC3, Which is not Increased During Starvation-Induced Autophagy in GECs. (A ) The LC3 A/B lipidation results of the same assay provided in . (B ) GECs were separately treated with LC3B siRNA (100nM) for 48h. P. g was added at MOI 100 to GECs for 6 h. Intracellular P. g survival after LC3B siRNA depletion was determined using a standard antibiotic protection assay using P. g- specific 16S rRNA primers. ( C ) GECs were subjected to starvation conditions in HBSS for 24 h. GECs were then collected and fixed so that immunofluorescence could be performed. GECs were stained for LC3C (rabbit anti-LC3C;Alexa 568; red). GECs were then imaged via confocal microscopy (Super Resolution Zeiss Airyscan LSM 880) at 63x. Western blotting (Not Shown) was utilized to confirm the lack of induction of LC3C I and LC3C II. Data is represented as Mean±SD; n=3; p<0.05 is considered statistically significant (Student two-tailed T-test).

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Immunofluorescence, Staining, Confocal Microscopy, Western Blot, Two Tailed Test

HSp27 Presence Permits the Prolonged Existence of LC3C-characterized, P. gingivalis Specific Autophagosomes by Hampering Canonical Autolysosomal Fusion in Primary GECs. ( A ) Human primary GECs were transfected with mCherry-eGFP-LC3C for 48 h. Select GECs were also treated with 1 uM of the autophagolysosomal fusion inhibitor Bafilomycin A1, 1 uM Pepstatin A, or 5 mM 3-MA. Others were treated with Hsp27 siRNA (100nM) for 24 h. P. g was added at MOI 100 to GECs, which were incubated for 24 h. ( A ) GECs were then stained for P. g (mouse anti- P.g; Alexa 405; blue) and were mounted. GECs were then imaged via confocal microscopy (Leica DM6 CS Stellaris 5 Confocal/Multiphoton System) at 63x. ( Ai ) Imaris was used to obtain a zoomed 63x orthogonal image of 24 h P. g infection and measure the high co-localization levels between P. g and the LC3C Reporter System. P. g localized readily to the LC3C construct, with a Pearson correlation coefficient of 0.82. (B) Separately, GECs were additionally stained for P. g (rabbit anti-P . gingivalis ; Alexa 488; green) and LAMP-1 (mouse anti-LAMP-1; Alexa 568; red) and were imaged. The range of all z-stacks was kept consistent and representative images were selected from the mid-ranged sections. Scale bar is 40 µm for 63x Magnification. ( Bi ) Imaris was used to obtain a zoomed 63x orthogonal image of 24 h P. g infection and measure the co-localization levels between P. g and LAMP-1 in infected and treated GECs. While P. g infected GECs did not exhibit high co-localization with LAMP-1 (Pearson correlation coefficient of .25), their HSp27-depleted counterparts did, with an average Pearson correlation coefficient of 0.83. The Scale bar is 20 µm for 63x Magnification. ( C ) Finally, GECs treated with autophagic inhibitors were targeted for P. g (rabbit anti- P. g ; goat anti-rabbit Ultra Small Gold Antibody) and labeled P. g was found to be readily ensconced within double-membraned autophagosomes in GECs. Representative transmission electron microscopy images of P. g -infected GECs were taken at 80 kV and 30000x or 100000x magnification. Following HSp27 depletion, P. g appeared to readily start to degrade, however treatment with late-stage autophagic inhibitors Bafilomycin A1 or Pepstatin A appeared to rescue P. g from degradation. Representative transmission electron microscopy images of P. g -infected GECs were taken at 80 kV and 30000x or 100000x magnification. Scale bar is 800 nm.

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: HSp27 Presence Permits the Prolonged Existence of LC3C-characterized, P. gingivalis Specific Autophagosomes by Hampering Canonical Autolysosomal Fusion in Primary GECs. ( A ) Human primary GECs were transfected with mCherry-eGFP-LC3C for 48 h. Select GECs were also treated with 1 uM of the autophagolysosomal fusion inhibitor Bafilomycin A1, 1 uM Pepstatin A, or 5 mM 3-MA. Others were treated with Hsp27 siRNA (100nM) for 24 h. P. g was added at MOI 100 to GECs, which were incubated for 24 h. ( A ) GECs were then stained for P. g (mouse anti- P.g; Alexa 405; blue) and were mounted. GECs were then imaged via confocal microscopy (Leica DM6 CS Stellaris 5 Confocal/Multiphoton System) at 63x. ( Ai ) Imaris was used to obtain a zoomed 63x orthogonal image of 24 h P. g infection and measure the high co-localization levels between P. g and the LC3C Reporter System. P. g localized readily to the LC3C construct, with a Pearson correlation coefficient of 0.82. (B) Separately, GECs were additionally stained for P. g (rabbit anti-P . gingivalis ; Alexa 488; green) and LAMP-1 (mouse anti-LAMP-1; Alexa 568; red) and were imaged. The range of all z-stacks was kept consistent and representative images were selected from the mid-ranged sections. Scale bar is 40 µm for 63x Magnification. ( Bi ) Imaris was used to obtain a zoomed 63x orthogonal image of 24 h P. g infection and measure the co-localization levels between P. g and LAMP-1 in infected and treated GECs. While P. g infected GECs did not exhibit high co-localization with LAMP-1 (Pearson correlation coefficient of .25), their HSp27-depleted counterparts did, with an average Pearson correlation coefficient of 0.83. The Scale bar is 20 µm for 63x Magnification. ( C ) Finally, GECs treated with autophagic inhibitors were targeted for P. g (rabbit anti- P. g ; goat anti-rabbit Ultra Small Gold Antibody) and labeled P. g was found to be readily ensconced within double-membraned autophagosomes in GECs. Representative transmission electron microscopy images of P. g -infected GECs were taken at 80 kV and 30000x or 100000x magnification. Following HSp27 depletion, P. g appeared to readily start to degrade, however treatment with late-stage autophagic inhibitors Bafilomycin A1 or Pepstatin A appeared to rescue P. g from degradation. Representative transmission electron microscopy images of P. g -infected GECs were taken at 80 kV and 30000x or 100000x magnification. Scale bar is 800 nm.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Transfection, Incubation, Staining, Confocal Microscopy, Infection, Construct, Labeling, Transmission Assay, Electron Microscopy

Depletion of LC3C via siRNA Collapses P. gingivalis (P. g) -Induced Non-Canonical Autophagosomal Integrity. Human primary GECs were treated with LC3C siRNA (100nM) for 48h. P. g was added at MOI 100 to GECs for 6, 12, or 24 h. ( A ) Intracellular P. g survival after LC3C siRNA depletion was determined using a standard antibiotic protection assay. In brief, any extracellular bacteria were killed via 1h gentamicin (300 μg/mL) and metronidazole (200 μg/mL) treatment. cDNAs were synthesized for qPCR using P. g -specific 16S rRNA primers to quantify intracellular levels of live P. g . Data is represented as Mean±SD, where n=3 and p<0.05 was considered as statistically significant via Student two-tailed T-test. *p<.05 **p<.005. ( B ) P. g -specific autophagosomes were also selectively isolated. Autophagosomes were stained for P. g (rabbit anti- P. g ; Alexa 488; green) and reduced GSH (ThiolTracker Violet; blue). Confocal images of P. g -specific autophagosomes at 6 h post-infection (63x) were taken utilizing the Super Resolution Zeiss Airyscan LSM 880.

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: Depletion of LC3C via siRNA Collapses P. gingivalis (P. g) -Induced Non-Canonical Autophagosomal Integrity. Human primary GECs were treated with LC3C siRNA (100nM) for 48h. P. g was added at MOI 100 to GECs for 6, 12, or 24 h. ( A ) Intracellular P. g survival after LC3C siRNA depletion was determined using a standard antibiotic protection assay. In brief, any extracellular bacteria were killed via 1h gentamicin (300 μg/mL) and metronidazole (200 μg/mL) treatment. cDNAs were synthesized for qPCR using P. g -specific 16S rRNA primers to quantify intracellular levels of live P. g . Data is represented as Mean±SD, where n=3 and p<0.05 was considered as statistically significant via Student two-tailed T-test. *p<.05 **p<.005. ( B ) P. g -specific autophagosomes were also selectively isolated. Autophagosomes were stained for P. g (rabbit anti- P. g ; Alexa 488; green) and reduced GSH (ThiolTracker Violet; blue). Confocal images of P. g -specific autophagosomes at 6 h post-infection (63x) were taken utilizing the Super Resolution Zeiss Airyscan LSM 880.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Bacteria, Synthesized, Two Tailed Test, Isolation, Staining, Infection

P. gingivalis (P. g) Causes the Nucleation of Hsp27-Mediated LC3C Accumulation and Lipidation; this Specific Assembly is Highly Dependent on Host Cells’ Redox Potential Determined by eATP Treatments. Human primary GECs were treated with HSp27 siRNA (100nM) for 48 h. P. g was added at MOI 100 to GECs, which were incubated 6 and 24 h. Non-Depleted and HSp27-depleted GECs also were treated with the physiologically-relevant oxidative stress inducer eATP (3mM) treatment for 30 min prior to infection, and were analyzed by western blot.

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: P. gingivalis (P. g) Causes the Nucleation of Hsp27-Mediated LC3C Accumulation and Lipidation; this Specific Assembly is Highly Dependent on Host Cells’ Redox Potential Determined by eATP Treatments. Human primary GECs were treated with HSp27 siRNA (100nM) for 48 h. P. g was added at MOI 100 to GECs, which were incubated 6 and 24 h. Non-Depleted and HSp27-depleted GECs also were treated with the physiologically-relevant oxidative stress inducer eATP (3mM) treatment for 30 min prior to infection, and were analyzed by western blot.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Incubation, Infection, Western Blot

P. gingivalis ( P. g ) Induces and Prolongs the Autophagosomal LC3C/Beclin 1/ATG14 Nucleation Complex in a Manner Dependent upon HSp27 and the Reduced Redox State of Infected GECs as Determined by Isolated P. g- Specific Autophagosomes. GECs were treated with HSP27siRNA (100nM) for 48 h. Select GECs were also treated with N-acetyl Cysteine (NAC)(50 uM) for 1 h and/or eATP (3mM) for 30 min. P. g was added at MOI 100 to GECs, which were incubated 6 and 12 h. Autophagosomes were then isolated and prepared for analysis. ( A ) The glutathione (GSH) levels of primary GECs were also measured using chemiluminescence detection. ( B) Isolated autophagosomes were analyzed via western blot. ( Bi ), ( Bii ), ( Biii ) Quantitative ImageJ analysis was performed of each of the western blot results. Data is represented as Mean±SD, where n=3 for results. p<0.05 was considered as statistically significant via Student two-tailed T-test. *p<.05 **p<.005

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: P. gingivalis ( P. g ) Induces and Prolongs the Autophagosomal LC3C/Beclin 1/ATG14 Nucleation Complex in a Manner Dependent upon HSp27 and the Reduced Redox State of Infected GECs as Determined by Isolated P. g- Specific Autophagosomes. GECs were treated with HSP27siRNA (100nM) for 48 h. Select GECs were also treated with N-acetyl Cysteine (NAC)(50 uM) for 1 h and/or eATP (3mM) for 30 min. P. g was added at MOI 100 to GECs, which were incubated 6 and 12 h. Autophagosomes were then isolated and prepared for analysis. ( A ) The glutathione (GSH) levels of primary GECs were also measured using chemiluminescence detection. ( B) Isolated autophagosomes were analyzed via western blot. ( Bi ), ( Bii ), ( Biii ) Quantitative ImageJ analysis was performed of each of the western blot results. Data is represented as Mean±SD, where n=3 for results. p<0.05 was considered as statistically significant via Student two-tailed T-test. *p<.05 **p<.005

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Infection, Isolation, Incubation, Western Blot, Two Tailed Test

HSp27 and LC3C Recruit Beclin 1 and ATG14 to Form a Temporal Pro-bacterial Autophagic Complex, which Can Be Disrupted by Increased Oxidative Stress. Human Primary GECs were treated with HSp27siRNA (100nM) for 48 h. Select GECs were also treated with N-acetyl Cysteine (NAC) (50 uM) for 1 h and/or eATP (3mM) for 30 min. P. gingivalis (P. g) was added at MOI 100 to GECs, which were incubated 6 and 12 h. GECs were then lysed and the extracts were incubated in rabbit anti-LC3C antibody over-night. Samples underwent co-immunoprecipitation. ( A ) The eluted protein complexes were then analyzed by western blot. ( Ai ), ( Aii ), and ( Aiii ) Quantitative ImageJ analysis of western blot results was performed for each of the proteins in question. ( B ) GECs also underwent staining for HSp27 (goat anti-HSp27; Alexa 405; blue), LC3C (rabbit anti-LC3C; Alexa 488; green), and Beclin 1 (sheep anti-Beclin 1; Alexa 568; red), and ATG14 (mouse anti-ATG14; Alexa 647; magenta) to examine the formation of the pro-bacterial autophagic initiation complex. GECs were then imaged via Leica DM6 CS Stellaris 5 Confocal/Multiphoton System at 63x. The Imaris software was used to obtain zoomed orthogonal views of ( Bi ) An infected GECs and ( Bii ) a theoretical autophagosome with HSp27, LC3C, ATG14, and Beclin 1 highly co-localized about it. The scale bar is 20 µm for all Magnification. All of the markers were found to have a Pearson correlation coefficient greater than .9 with each other via Imaris, denoting their close theorized interactions. Data is represented as Mean±SD, where n=3 and p<0.05 was considered as statistically significant via Student two-tailed T-test. *p<.05 **p<.005

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: HSp27 and LC3C Recruit Beclin 1 and ATG14 to Form a Temporal Pro-bacterial Autophagic Complex, which Can Be Disrupted by Increased Oxidative Stress. Human Primary GECs were treated with HSp27siRNA (100nM) for 48 h. Select GECs were also treated with N-acetyl Cysteine (NAC) (50 uM) for 1 h and/or eATP (3mM) for 30 min. P. gingivalis (P. g) was added at MOI 100 to GECs, which were incubated 6 and 12 h. GECs were then lysed and the extracts were incubated in rabbit anti-LC3C antibody over-night. Samples underwent co-immunoprecipitation. ( A ) The eluted protein complexes were then analyzed by western blot. ( Ai ), ( Aii ), and ( Aiii ) Quantitative ImageJ analysis of western blot results was performed for each of the proteins in question. ( B ) GECs also underwent staining for HSp27 (goat anti-HSp27; Alexa 405; blue), LC3C (rabbit anti-LC3C; Alexa 488; green), and Beclin 1 (sheep anti-Beclin 1; Alexa 568; red), and ATG14 (mouse anti-ATG14; Alexa 647; magenta) to examine the formation of the pro-bacterial autophagic initiation complex. GECs were then imaged via Leica DM6 CS Stellaris 5 Confocal/Multiphoton System at 63x. The Imaris software was used to obtain zoomed orthogonal views of ( Bi ) An infected GECs and ( Bii ) a theoretical autophagosome with HSp27, LC3C, ATG14, and Beclin 1 highly co-localized about it. The scale bar is 20 µm for all Magnification. All of the markers were found to have a Pearson correlation coefficient greater than .9 with each other via Imaris, denoting their close theorized interactions. Data is represented as Mean±SD, where n=3 and p<0.05 was considered as statistically significant via Student two-tailed T-test. *p<.05 **p<.005

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Incubation, Immunoprecipitation, Western Blot, Staining, Software, Infection, Two Tailed Test

HSp27 and LC3C Selectively and Specifically Partner with One Another to Promote P. gingivalis ( P. g )-Induced Autophagy. P. g was added at MOI 100 to Human Primary GECs, which were incubated 6 and 24 h. ( A ) GECs were stained for LC3C (rabbit anti-LC3C; Alexa 488; green) and HSp27 (mouse anti-HSp37; Alexa 568; red) following infection. HSp27 was found to readily and temporally colocalize with LC3C, having a Pearsons correlation coefficient of .85 at 24 h post infection via the Imaris post-processing software. ( B ) To assess if full length HSp27 is truly capable of binding to full-length LC3C, a far western approach was implemented by probing 5 µg of recombinant LC3C with 10 µg of recombinant HSp27 for one hour. Antibody specificity was accounted for via probing the LC3C blot with monoclonal mouse anti-HSp27 antibody (Not shown), which showed no cross-reactivity.

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: HSp27 and LC3C Selectively and Specifically Partner with One Another to Promote P. gingivalis ( P. g )-Induced Autophagy. P. g was added at MOI 100 to Human Primary GECs, which were incubated 6 and 24 h. ( A ) GECs were stained for LC3C (rabbit anti-LC3C; Alexa 488; green) and HSp27 (mouse anti-HSp37; Alexa 568; red) following infection. HSp27 was found to readily and temporally colocalize with LC3C, having a Pearsons correlation coefficient of .85 at 24 h post infection via the Imaris post-processing software. ( B ) To assess if full length HSp27 is truly capable of binding to full-length LC3C, a far western approach was implemented by probing 5 µg of recombinant LC3C with 10 µg of recombinant HSp27 for one hour. Antibody specificity was accounted for via probing the LC3C blot with monoclonal mouse anti-HSp27 antibody (Not shown), which showed no cross-reactivity.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Incubation, Staining, Infection, Software, Binding Assay, Western Blot, Recombinant

HSp27 does not Interact with either LC3A or LC3B isoforms in the way that it interacts with LC3C. A Far Western approach was implemented. rLC3A or rLC3B were loaded and incubated with 10 ug of rHSp27. Interactions for ( Bi ) LC3A and ( Bii ) LC3B were then detected by probing the rLC3A or rLC3B blot with mouse Anti-Hsp27 antibody.

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: HSp27 does not Interact with either LC3A or LC3B isoforms in the way that it interacts with LC3C. A Far Western approach was implemented. rLC3A or rLC3B were loaded and incubated with 10 ug of rHSp27. Interactions for ( Bi ) LC3A and ( Bii ) LC3B were then detected by probing the rLC3A or rLC3B blot with mouse Anti-Hsp27 antibody.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Western Blot, Incubation

Phosphorylated HSp27 (P-HSp27) Preferentially Binds to the C-terminal Tail of LC3C, Inhibiting the Canonical Cleavage of LC3C and Halting the Canonical Maturation of LC3C-Specific Autophagosomes. The structural models of monomeric full-length wild-type ( A ) HSp27 (Uniprot: P04792) and ( B ) LC3C (Uniprot: Q9BXW4) were acquired from the AlphaFold database. Optimized complex configurations between ( C ) LC3C and unmodified HSp27 and ( D ) LC3C and P-HSp27 were then obtained, and the modifications in the theorized interaction sites in their N-terminal regions were highlighted. ( E ) Surface electrostatic potentials of the complexes were additionally mapped, contrasting the varied potentials between the two complexes. ( F ) Finally, the buried surface areas and interaction areas between HSp27 or P-HSp27 and LC3C proteins were also assessed and contact maps were generated.

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: Phosphorylated HSp27 (P-HSp27) Preferentially Binds to the C-terminal Tail of LC3C, Inhibiting the Canonical Cleavage of LC3C and Halting the Canonical Maturation of LC3C-Specific Autophagosomes. The structural models of monomeric full-length wild-type ( A ) HSp27 (Uniprot: P04792) and ( B ) LC3C (Uniprot: Q9BXW4) were acquired from the AlphaFold database. Optimized complex configurations between ( C ) LC3C and unmodified HSp27 and ( D ) LC3C and P-HSp27 were then obtained, and the modifications in the theorized interaction sites in their N-terminal regions were highlighted. ( E ) Surface electrostatic potentials of the complexes were additionally mapped, contrasting the varied potentials between the two complexes. ( F ) Finally, the buried surface areas and interaction areas between HSp27 or P-HSp27 and LC3C proteins were also assessed and contact maps were generated.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Generated

P. gingivalis (P. g) Secretes its Ndk Effector Molecule to Activate HSp27 and Induce Temporal HSp27-LC3C Partnering to Inhibit Canonical LC3C Cleavage by ATG4B and Halt Autolyosomal Fusion in GECs. A) Human primary GECs were treated with HSp27 siRNA (100nM) for 48 h or were transfected with 1 µg of the constitutively activated pFLAG-CMV2-HSP27-S78D/S82D construct for 48h. Select GECs were then jointly treated with the late stage autophagy inhibitors 1 µM Pepstatin A, or 1 µM lactostatin for 24h. Wild-type P. g or ΔNDK P. g was then added at MOI 100 to GECs, which were incubated for 24 h. ( A ) GECs also underwent staining for HSp27 (goat anti-HSp27; Alexa 405; blue), LC3C (rabbit anti-LC3C; Alexa 488; green), and Beclin 1 (sheep anti-Beclin 1; Alexa 568; red), and ATG14 (mouse anti-ATG14; Alexa 647; magenta) to examine the formation of the pro-bacterial autophagic initiation complex. GECs were then imaged via Leica DM6 CS Stellaris 5 Confocal/Multiphoton System at 63x. ( B ) A diagram was created detailing how LC3C preferentially partners to P-HSp27 over its non-phosphorylated counterpart, causing a confirmational shift to the C-terminal tail of LC3C. This shift results in the inhibition of the final lipidated LC3C tail cleavage by the ATG4B protease, lending to LC3C not disassociating from the autophagosome and halting fusion with the lysosome. ( C ) A diagram was also created to highlight the temporal relationship between HSp27 and LC3C, where LC3C can initially bind to HSp27 but via the actions of Ndk, it preferentially binds to P-HSp27, resulting in a limiting of mature, cleaved LC3C.

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: P. gingivalis (P. g) Secretes its Ndk Effector Molecule to Activate HSp27 and Induce Temporal HSp27-LC3C Partnering to Inhibit Canonical LC3C Cleavage by ATG4B and Halt Autolyosomal Fusion in GECs. A) Human primary GECs were treated with HSp27 siRNA (100nM) for 48 h or were transfected with 1 µg of the constitutively activated pFLAG-CMV2-HSP27-S78D/S82D construct for 48h. Select GECs were then jointly treated with the late stage autophagy inhibitors 1 µM Pepstatin A, or 1 µM lactostatin for 24h. Wild-type P. g or ΔNDK P. g was then added at MOI 100 to GECs, which were incubated for 24 h. ( A ) GECs also underwent staining for HSp27 (goat anti-HSp27; Alexa 405; blue), LC3C (rabbit anti-LC3C; Alexa 488; green), and Beclin 1 (sheep anti-Beclin 1; Alexa 568; red), and ATG14 (mouse anti-ATG14; Alexa 647; magenta) to examine the formation of the pro-bacterial autophagic initiation complex. GECs were then imaged via Leica DM6 CS Stellaris 5 Confocal/Multiphoton System at 63x. ( B ) A diagram was created detailing how LC3C preferentially partners to P-HSp27 over its non-phosphorylated counterpart, causing a confirmational shift to the C-terminal tail of LC3C. This shift results in the inhibition of the final lipidated LC3C tail cleavage by the ATG4B protease, lending to LC3C not disassociating from the autophagosome and halting fusion with the lysosome. ( C ) A diagram was also created to highlight the temporal relationship between HSp27 and LC3C, where LC3C can initially bind to HSp27 but via the actions of Ndk, it preferentially binds to P-HSp27, resulting in a limiting of mature, cleaved LC3C.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Transfection, Construct, Incubation, Staining, Inhibition

Cross-Sectional Human in Situ Sample and Expression Analyses Support High Levels and Increased Co-localization of P. gingivalis (P. g) , HSp27, and LC3C in Periodontitis-Afflicted Oral Tissues. Publicly available mRNA expression data (GEO accession: GSE79705) was obtained from previously collected and examined periodontitis-afflicted and healthy gingival tissues. This microarray expression data was then analyzed via GEO2R and the relative levels of ( A ) HSp27 and ( B ) LC3C were obtained and compared. Data is represented as Mean±SD, where n=12 and p<0.05 was considered as statistically significant via One-Way Anova. *p<0.05. Representative confocal images of gingival biopsy specimens from healthy individuals and periodontitis-afflicted patients were also taken and examined. DAPI staining was utilized to visualize cellular DNA. ( C ) P. g (mouse anti-P . gingivalis ; Alexa 488; green) and LC3C (rabbit anti-LC3C; Alexa 594; red) were detected via dual staining. ( D ) HSp27 (mouse anti-HSp27; Alexa 488; green) and LC3C detection (rabbit anti-LC3C; Alexa 594; red) were also detected. Images were then captured using super resolution confocal laser scanning microscopy (Leica DM6 CS Stellaris 5 Confocal/Multiphoton System) at 10x and 63x magnification with oil immersion. Zoomed (2x) 3D versions of the 63x magnifications were obtained via the Imaris software. The range of z-stacks was kept consistent. SC: Stratum corneum, SL: Stratum lucidum, SG: Stratum granulosum, SB: Stratum basale, LT: Lamina propria. Scale bars = 200µm for 10x and 20 µm for 63x. Quantification of mean fluorescence intensity provided in Supplement. LC3C and HSp27 both were found to exhibit high levels of co-localization with each other and with P. g, as the Pearson coefficient was calculated to be .93 for LC3C and P. g and .85 for LC3C and HSp27 via the Imaris Software at the most severe state of disease.

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: Cross-Sectional Human in Situ Sample and Expression Analyses Support High Levels and Increased Co-localization of P. gingivalis (P. g) , HSp27, and LC3C in Periodontitis-Afflicted Oral Tissues. Publicly available mRNA expression data (GEO accession: GSE79705) was obtained from previously collected and examined periodontitis-afflicted and healthy gingival tissues. This microarray expression data was then analyzed via GEO2R and the relative levels of ( A ) HSp27 and ( B ) LC3C were obtained and compared. Data is represented as Mean±SD, where n=12 and p<0.05 was considered as statistically significant via One-Way Anova. *p<0.05. Representative confocal images of gingival biopsy specimens from healthy individuals and periodontitis-afflicted patients were also taken and examined. DAPI staining was utilized to visualize cellular DNA. ( C ) P. g (mouse anti-P . gingivalis ; Alexa 488; green) and LC3C (rabbit anti-LC3C; Alexa 594; red) were detected via dual staining. ( D ) HSp27 (mouse anti-HSp27; Alexa 488; green) and LC3C detection (rabbit anti-LC3C; Alexa 594; red) were also detected. Images were then captured using super resolution confocal laser scanning microscopy (Leica DM6 CS Stellaris 5 Confocal/Multiphoton System) at 10x and 63x magnification with oil immersion. Zoomed (2x) 3D versions of the 63x magnifications were obtained via the Imaris software. The range of z-stacks was kept consistent. SC: Stratum corneum, SL: Stratum lucidum, SG: Stratum granulosum, SB: Stratum basale, LT: Lamina propria. Scale bars = 200µm for 10x and 20 µm for 63x. Quantification of mean fluorescence intensity provided in Supplement. LC3C and HSp27 both were found to exhibit high levels of co-localization with each other and with P. g, as the Pearson coefficient was calculated to be .93 for LC3C and P. g and .85 for LC3C and HSp27 via the Imaris Software at the most severe state of disease.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: In Situ, Expressing, Microarray, Staining, Confocal Laser Scanning Microscopy, Software, Fluorescence

Quantifications of Cross-Sectional Human Ex-Vivo Samples Support High Levels of P. gingivalis (P. g) , HSp27, and LC3C in Chronically Diseased Oral Tissues (i.e. Periodontitis). Representative confocal images of gingival biopsy specimens from healthy individuals and periodontitis patients were obtained using the Leica DM6 CS Stellaris 5 Confocal/Multiphoton System so that the mean fluorescence intensity of ( A ) HSp27 ( B ) P. g and ( C ) LC3C could be calculated using ImageJ with JACoP Plugin. Data are presented as mean ± SD. Representative images from at least 5 different patients per group were used for quantitative analysis and p<0.05 was considered as statistically significant via Student two-tailed T-test. *p<.05 **p<.005

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: Quantifications of Cross-Sectional Human Ex-Vivo Samples Support High Levels of P. gingivalis (P. g) , HSp27, and LC3C in Chronically Diseased Oral Tissues (i.e. Periodontitis). Representative confocal images of gingival biopsy specimens from healthy individuals and periodontitis patients were obtained using the Leica DM6 CS Stellaris 5 Confocal/Multiphoton System so that the mean fluorescence intensity of ( A ) HSp27 ( B ) P. g and ( C ) LC3C could be calculated using ImageJ with JACoP Plugin. Data are presented as mean ± SD. Representative images from at least 5 different patients per group were used for quantitative analysis and p<0.05 was considered as statistically significant via Student two-tailed T-test. *p<.05 **p<.005

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Ex Vivo, Fluorescence, Two Tailed Test

HSp27 is a Critical Regulator in Pro-bacterial LC3C-Characterized Autophagy, Facilitating the Intracellular Autophagic Survival of P. gingivalis (P. g) and Influencing the Bacterial Symbiosis of the Oral Mucosa. The proposed diagram of the identified mechanisms of P. gingivalis persistence in GECs. ( A ) HSp27 is largely induced and spatially recruited by P. g invasion of the host cells. After the initial periods of cellular infection, the gradually growing secretion of the bacterial Nucleoside-diphosphate-kinase (Ndk) into the cytoplasmic space causes heightened activation of HSp27 (P-HSp27) via direct phosphorylation. P-HSp27 abrogates extracellular ATP (eATP)-induced antimicrobial Reactive-Oxygen-Species (ROS) production via increasing glutathione (GSH) levels. In parallel, P. g -mediated induction of HSp27 promotes the specific recruitment and lipidation of LC3C, an isomer of the LC3 autophagosomal structural molecule, which is strictly dependent upon the large presence and the strong antioxidant activity of HSp27. LC3C and HSp27 partner in a stepwise manner, 1) their coupling drives the formation of Beclin1/ATG14 induction, 2) where the temporally increased phosphorylation of HSp27 by P. g Ndk both strengthens the P-HSP27 and LC3C partnering and shifts the confirmation of the LC3C tail so that LC3C cannot be successfully further cleaved by ATG4. ( B ) P-HSp27 and LC3C become increasingly assembled to the ATG14-Incorperated Nucleation Complex, where they prolong the complex’s formation and result in the accumulation of the complex on forming autophagic membranes. Thus, the strengthened partnering between P-HSp27 and LC3C is the proposed mechanism for inhibiting the autolysosomal fusion of P. g- specific autophagosomes, which is also controlled by the host cell redox homeostasis ( C ) Autophagic P. g does not undergo lysosomal degradation and is instead able to survive, multiply and subsequently intercellularly spread to neighboring cells to propagate. ( D ) Thus, the non-canonical, pro-bacterial autophagic events create a favorable and protected cellular environment for P. g , thereby establishing long-term intracellular bacterial persistence. The chronic colonization of P. g in the epithelia can lead to host-microbial dysbiosis in oral mucosa and systemic disorders.

Journal: bioRxiv

Article Title: Porphyromonas gingivalis activates Heat-Shock-Protein 27 to drive a LC3C-specific probacterial form of select autophagy that is redox sensitive for intracellular bacterial survival in human gingival mucosa

doi: 10.1101/2024.07.01.601539

Figure Lengend Snippet: HSp27 is a Critical Regulator in Pro-bacterial LC3C-Characterized Autophagy, Facilitating the Intracellular Autophagic Survival of P. gingivalis (P. g) and Influencing the Bacterial Symbiosis of the Oral Mucosa. The proposed diagram of the identified mechanisms of P. gingivalis persistence in GECs. ( A ) HSp27 is largely induced and spatially recruited by P. g invasion of the host cells. After the initial periods of cellular infection, the gradually growing secretion of the bacterial Nucleoside-diphosphate-kinase (Ndk) into the cytoplasmic space causes heightened activation of HSp27 (P-HSp27) via direct phosphorylation. P-HSp27 abrogates extracellular ATP (eATP)-induced antimicrobial Reactive-Oxygen-Species (ROS) production via increasing glutathione (GSH) levels. In parallel, P. g -mediated induction of HSp27 promotes the specific recruitment and lipidation of LC3C, an isomer of the LC3 autophagosomal structural molecule, which is strictly dependent upon the large presence and the strong antioxidant activity of HSp27. LC3C and HSp27 partner in a stepwise manner, 1) their coupling drives the formation of Beclin1/ATG14 induction, 2) where the temporally increased phosphorylation of HSp27 by P. g Ndk both strengthens the P-HSP27 and LC3C partnering and shifts the confirmation of the LC3C tail so that LC3C cannot be successfully further cleaved by ATG4. ( B ) P-HSp27 and LC3C become increasingly assembled to the ATG14-Incorperated Nucleation Complex, where they prolong the complex’s formation and result in the accumulation of the complex on forming autophagic membranes. Thus, the strengthened partnering between P-HSp27 and LC3C is the proposed mechanism for inhibiting the autolysosomal fusion of P. g- specific autophagosomes, which is also controlled by the host cell redox homeostasis ( C ) Autophagic P. g does not undergo lysosomal degradation and is instead able to survive, multiply and subsequently intercellularly spread to neighboring cells to propagate. ( D ) Thus, the non-canonical, pro-bacterial autophagic events create a favorable and protected cellular environment for P. g , thereby establishing long-term intracellular bacterial persistence. The chronic colonization of P. g in the epithelia can lead to host-microbial dysbiosis in oral mucosa and systemic disorders.

Article Snippet: Antibody cross-reactivity was accounted for via probing non-incubated LC3C blots with mouse anti-HSp27 antibody (Santa Cruz Biotechnology, sc-13132; 1:1000).

Techniques: Infection, Activation Assay, Phospho-proteomics, Antioxidant Activity Assay

RNAi screening identifies RABGAP1L as an IAV restriction factor (A) Schematic representation of recombinant IAV WSN/33 in which the coding region for the hemagglutinin (HA) glycoprotein has been replaced by Renilla luciferase (WSN/33- Renilla ). (B) RNAi-screening experimental workflow. (C) MRC-5-HA cells were transfected for 30 h with individual siRNAs targeting MX1 or IFITM3 or with a non-targeting (NT) control siRNA. Following stimulation with IFNα2 (1,000 U/mL or mock) for 16 h, cells were infected with WSN/33- Renilla (MOI 5 PFU/cell) in the presence of the live-cell substrate EnduRen. Luciferase activity was monitored up to 12 h post-infection (p.i.), and the area under the curve (AUC) was calculated as indicated. Mean values from 50 technical replicates across two independent biological experiments are plotted, with error bars representing SDs. (D) Hit criteria for RNAi screening. In a primary screen following the workflow in (B), 100 putative ISGs were silenced with four individual siRNAs each. Twenty-two genes met the threshold, and 20 were re-tested in a confirmation screen. Applying the same hit criteria, a total of 8 putative ISGs were confirmed in both screening rounds. (E) Heatmap showing Z scores of positive controls ( MX1 and IFITM3 ) and the top 8 hits from the two RNAi-screening rounds. Columns represent individual siRNAs targeting genes listed in rows. See also .

Journal: Cell Reports

Article Title: Restriction factor screening identifies RABGAP1L-mediated disruption of endocytosis as a host antiviral defense

doi: 10.1016/j.celrep.2022.110549

Figure Lengend Snippet: RNAi screening identifies RABGAP1L as an IAV restriction factor (A) Schematic representation of recombinant IAV WSN/33 in which the coding region for the hemagglutinin (HA) glycoprotein has been replaced by Renilla luciferase (WSN/33- Renilla ). (B) RNAi-screening experimental workflow. (C) MRC-5-HA cells were transfected for 30 h with individual siRNAs targeting MX1 or IFITM3 or with a non-targeting (NT) control siRNA. Following stimulation with IFNα2 (1,000 U/mL or mock) for 16 h, cells were infected with WSN/33- Renilla (MOI 5 PFU/cell) in the presence of the live-cell substrate EnduRen. Luciferase activity was monitored up to 12 h post-infection (p.i.), and the area under the curve (AUC) was calculated as indicated. Mean values from 50 technical replicates across two independent biological experiments are plotted, with error bars representing SDs. (D) Hit criteria for RNAi screening. In a primary screen following the workflow in (B), 100 putative ISGs were silenced with four individual siRNAs each. Twenty-two genes met the threshold, and 20 were re-tested in a confirmation screen. Applying the same hit criteria, a total of 8 putative ISGs were confirmed in both screening rounds. (E) Heatmap showing Z scores of positive controls ( MX1 and IFITM3 ) and the top 8 hits from the two RNAi-screening rounds. Columns represent individual siRNAs targeting genes listed in rows. See also .

Article Snippet: Proteins were detected by western blotting using the following primary antibodies: actin (rabbit, catalog no. A2103; Sigma-Aldrich), β-actin (mouse, catalog no.sc-47778; Santa Cruz), RABGAP1L (rabbit, catalog no. 13894-1-AP; proteintech), MxA (mouse ab143, kindly provided by Jovan Pavlovic, University of Zurich) , STAT1 (mouse, catalog no. sc-417; Santa Cruz), pSTAT1-Y701 (rabbit, catalog no. 7649S; Cell Signaling), IFI44 (rabbit, catalog no. HPA043858; Atlas Antibodies), FLAG M2 (mouse, catalog no. F1804; Sigma-Aldrich), PB1 (rabbit, catalog no. GTX125923; Genetex), PB2 (rabbit, inhouse), PA (rabbit, catalog no. GTX118991; Genetex), NP (mouse HB65, catalog no. H16-L10-4R5, ATCC), V5 (mouse, catalog no. MCA1360; Bio-Rad), VPS33A (rabbit, catalog no. 16896-1-AP, proteintech), RAB27B (rabbit, catalog no. 13412-1-AP, proteintech), SNF8 (mouse, catalog no. sc-390747, Santa Cruz), A/WSN/33 HA1 (rabbit, catalog no. 11692-T54; Sino Biological) and EEA1 (rabbit, catalog no. 2411, Cell Signaling).

Techniques: Recombinant, Luciferase, Transfection, Infection, Activity Assay

IFN-mediated restriction of IAV by RABGAP1L (A) A549 cells were transfected with the indicated siRNAs for 32 or 60 h prior to lysis and assessment of cell viability using CellTiter-Glo. An NT siRNA and an siRNA targeting IRF9 were used as negative controls. siRPS is an siRNA targeting the essential gene RPS27A and thus acted as a positive control for cell toxicity. Mean values from three biologically independent experiments are plotted, with error bars representing SDs. Individual data points are shown. (B and C) A549 cells were transfected with the indicated siRNAs 30 h prior to IFNα2 treatment (1,000 U/mL or mock). Sixteen hours post-IFN stimulation, cells were infected with WSN/33- Renilla (MOI 1 PFU/cell), and luciferase activity was monitored every 2 h for a total of 12 h. The NT siRNA and siRNA targeting IRF9 were used as controls. (C) The AUC was calculated from measured relative light units (RLUs) over time. Mean values from three biologically independent experiments are plotted, with error bars representing SDs. Individual data points are shown. (D) In parallel to (B) and (C), cells were harvested for western blot analysis 16 h post-IFN stimulation. Proteins of interest were detected as indicated. RABGAP1L (RG1L) isoforms corresponding to detected bands are highlighted. (E) Schematic representation of RABGAP1L isoforms A, G, H, and I, showing the phosphotyrosine-binding (PTB) domain, the kinesin-like (kin) domain, and the Tre-2/Bub2/Cdc16 (TBC) domain. Isoform G further contains a domain of unknown function (DUF3084). (F) Immunofluorescence analysis of A549 cells stably expressing either empty vector (EV) or RABGAP1L isoforms A, G, H, and I. Cells were fixed and stained for RABGAP1L (red); nuclei were stained with DAPI (blue). Scale bar represents 25 μm. Representative confocal-microscopy images from at least two biologically independent experiments are shown. (G) Cells described in (F) were harvested for western-blot analysis. Proteins of interest were detected with the indicated antibodies. Images are representative of three biologically independent experiments. (H) Cells described in (F) and (G) were treated with IFNα2 (1,000 U/mL or mock) 16 h prior to infection with WSN/33 (MOI 0.001 PFU/cell). Supernatants were collected 48 h p.i. and titrated on Madin-Darby canine kidney (MDCK) cells to determine viral titers. Mean values from three biologically independent experiments are plotted, with error bars representing SDs. Individual data points are shown. Statistical significance in (C) and (H) was determined using one-way ANOVA following log transformation ( ∗ p < 0.05, ∗∗ p < 0.002, ∗∗∗∗ p < 0.0001; ns, non-significant). See also and .

Journal: Cell Reports

Article Title: Restriction factor screening identifies RABGAP1L-mediated disruption of endocytosis as a host antiviral defense

doi: 10.1016/j.celrep.2022.110549

Figure Lengend Snippet: IFN-mediated restriction of IAV by RABGAP1L (A) A549 cells were transfected with the indicated siRNAs for 32 or 60 h prior to lysis and assessment of cell viability using CellTiter-Glo. An NT siRNA and an siRNA targeting IRF9 were used as negative controls. siRPS is an siRNA targeting the essential gene RPS27A and thus acted as a positive control for cell toxicity. Mean values from three biologically independent experiments are plotted, with error bars representing SDs. Individual data points are shown. (B and C) A549 cells were transfected with the indicated siRNAs 30 h prior to IFNα2 treatment (1,000 U/mL or mock). Sixteen hours post-IFN stimulation, cells were infected with WSN/33- Renilla (MOI 1 PFU/cell), and luciferase activity was monitored every 2 h for a total of 12 h. The NT siRNA and siRNA targeting IRF9 were used as controls. (C) The AUC was calculated from measured relative light units (RLUs) over time. Mean values from three biologically independent experiments are plotted, with error bars representing SDs. Individual data points are shown. (D) In parallel to (B) and (C), cells were harvested for western blot analysis 16 h post-IFN stimulation. Proteins of interest were detected as indicated. RABGAP1L (RG1L) isoforms corresponding to detected bands are highlighted. (E) Schematic representation of RABGAP1L isoforms A, G, H, and I, showing the phosphotyrosine-binding (PTB) domain, the kinesin-like (kin) domain, and the Tre-2/Bub2/Cdc16 (TBC) domain. Isoform G further contains a domain of unknown function (DUF3084). (F) Immunofluorescence analysis of A549 cells stably expressing either empty vector (EV) or RABGAP1L isoforms A, G, H, and I. Cells were fixed and stained for RABGAP1L (red); nuclei were stained with DAPI (blue). Scale bar represents 25 μm. Representative confocal-microscopy images from at least two biologically independent experiments are shown. (G) Cells described in (F) were harvested for western-blot analysis. Proteins of interest were detected with the indicated antibodies. Images are representative of three biologically independent experiments. (H) Cells described in (F) and (G) were treated with IFNα2 (1,000 U/mL or mock) 16 h prior to infection with WSN/33 (MOI 0.001 PFU/cell). Supernatants were collected 48 h p.i. and titrated on Madin-Darby canine kidney (MDCK) cells to determine viral titers. Mean values from three biologically independent experiments are plotted, with error bars representing SDs. Individual data points are shown. Statistical significance in (C) and (H) was determined using one-way ANOVA following log transformation ( ∗ p < 0.05, ∗∗ p < 0.002, ∗∗∗∗ p < 0.0001; ns, non-significant). See also and .

Article Snippet: Proteins were detected by western blotting using the following primary antibodies: actin (rabbit, catalog no. A2103; Sigma-Aldrich), β-actin (mouse, catalog no.sc-47778; Santa Cruz), RABGAP1L (rabbit, catalog no. 13894-1-AP; proteintech), MxA (mouse ab143, kindly provided by Jovan Pavlovic, University of Zurich) , STAT1 (mouse, catalog no. sc-417; Santa Cruz), pSTAT1-Y701 (rabbit, catalog no. 7649S; Cell Signaling), IFI44 (rabbit, catalog no. HPA043858; Atlas Antibodies), FLAG M2 (mouse, catalog no. F1804; Sigma-Aldrich), PB1 (rabbit, catalog no. GTX125923; Genetex), PB2 (rabbit, inhouse), PA (rabbit, catalog no. GTX118991; Genetex), NP (mouse HB65, catalog no. H16-L10-4R5, ATCC), V5 (mouse, catalog no. MCA1360; Bio-Rad), VPS33A (rabbit, catalog no. 16896-1-AP, proteintech), RAB27B (rabbit, catalog no. 13412-1-AP, proteintech), SNF8 (mouse, catalog no. sc-390747, Santa Cruz), A/WSN/33 HA1 (rabbit, catalog no. 11692-T54; Sino Biological) and EEA1 (rabbit, catalog no. 2411, Cell Signaling).

Techniques: Transfection, Lysis, Positive Control, Infection, Luciferase, Activity Assay, Western Blot, Binding Assay, Immunofluorescence, Stable Transfection, Expressing, Plasmid Preparation, Staining, Confocal Microscopy, Transformation Assay

RABGAP1L overexpression restricts selected positive- and negative-sense RNA viruses (A) A549 cells stably expressing GFP or RABGAP1L (RG1L) were stimulated with IFNα2 (1,000 U/mL or mock) 16 h prior to infection with different Renilla luciferase-encoding IAVs: H1N1 (WSN/33, MOI 1 PFU/cell), pdmH1N1 (Neth/09, MOI 5 PFU/cell), or H5N1 (Viet/04, MOI 0.5 PFU/cell). EnduRen live-cell substrate was added p.i., and the luciferase activity was monitored every 2 h for a total of 11 h. The AUC was calculated from RLUs up to 11 h p.i. (B) Huh-7 cells stably expressing GFP or RG1L were treated as described in (A) and infected with WSN/33- Renilla (MOI 1 PFU/cell) or HCoV-229E- Renilla (MOI 5 PFU/cell). EnduRen was supplemented, and the luciferase activity was measured every 2 h for a total of 11 h. RLUs were used to calculate the AUC. (C–E) A549 cells expressing EV or RG1L were stimulated with IFNα2 (10, 100 or 1,000 U/mL or mock) for 4 h prior to infection with VSV-GFP (MOI 1 PFU/cell) (C) or for 16 h prior to infection with SeV-GFP (MOI ∼1 PFU/cell) (D) and NDV-GFP (MOI 1 PFU/cell) (E). GFP intensity was measured every 2 h for up to 72 h. The AUC was calculated from total green integrated intensity. (F and H) Calu-3 (F) or Vero-CCL81 (H) cells stably expressing GFP or RG1L were treated with IFNα2 (10, 100, or 1,000 U/mL or mock) for 16 h, followed by infection with WSN/33- Renilla (MOI 1 PFU/cell). EnduRen was added p.i., and the luciferase activity was monitored every 2 h for a total of 11 h. The AUC was calculated from RLUs. (G and I) Calu-3 (G) or Vero-CCL81 (I) cells stably expressing GFP or RG1L were treated as described in (F) prior to infection with SARS-CoV-2 (MOI 0.1 PFU/cell). Supernatants were collected 24 h p.i., and viral titers were determined by plaque assay in Vero-E6 cells. (A–I) Mean values from three biologically independent experiments are plotted, with error bars representing SDs. Individual data points are shown. Statistical significance was determined comparing GFP-overexpressing with RG1L-overexpressing cells in equal treatment conditions in all panels using one-way ANOVA following log transformation ( ∗ p < 0.05, ∗∗ p < 0.002, ∗∗∗ p < 0.0002, ∗∗∗∗ p < 0.0001; ns, non-significant).

Journal: Cell Reports

Article Title: Restriction factor screening identifies RABGAP1L-mediated disruption of endocytosis as a host antiviral defense

doi: 10.1016/j.celrep.2022.110549

Figure Lengend Snippet: RABGAP1L overexpression restricts selected positive- and negative-sense RNA viruses (A) A549 cells stably expressing GFP or RABGAP1L (RG1L) were stimulated with IFNα2 (1,000 U/mL or mock) 16 h prior to infection with different Renilla luciferase-encoding IAVs: H1N1 (WSN/33, MOI 1 PFU/cell), pdmH1N1 (Neth/09, MOI 5 PFU/cell), or H5N1 (Viet/04, MOI 0.5 PFU/cell). EnduRen live-cell substrate was added p.i., and the luciferase activity was monitored every 2 h for a total of 11 h. The AUC was calculated from RLUs up to 11 h p.i. (B) Huh-7 cells stably expressing GFP or RG1L were treated as described in (A) and infected with WSN/33- Renilla (MOI 1 PFU/cell) or HCoV-229E- Renilla (MOI 5 PFU/cell). EnduRen was supplemented, and the luciferase activity was measured every 2 h for a total of 11 h. RLUs were used to calculate the AUC. (C–E) A549 cells expressing EV or RG1L were stimulated with IFNα2 (10, 100 or 1,000 U/mL or mock) for 4 h prior to infection with VSV-GFP (MOI 1 PFU/cell) (C) or for 16 h prior to infection with SeV-GFP (MOI ∼1 PFU/cell) (D) and NDV-GFP (MOI 1 PFU/cell) (E). GFP intensity was measured every 2 h for up to 72 h. The AUC was calculated from total green integrated intensity. (F and H) Calu-3 (F) or Vero-CCL81 (H) cells stably expressing GFP or RG1L were treated with IFNα2 (10, 100, or 1,000 U/mL or mock) for 16 h, followed by infection with WSN/33- Renilla (MOI 1 PFU/cell). EnduRen was added p.i., and the luciferase activity was monitored every 2 h for a total of 11 h. The AUC was calculated from RLUs. (G and I) Calu-3 (G) or Vero-CCL81 (I) cells stably expressing GFP or RG1L were treated as described in (F) prior to infection with SARS-CoV-2 (MOI 0.1 PFU/cell). Supernatants were collected 24 h p.i., and viral titers were determined by plaque assay in Vero-E6 cells. (A–I) Mean values from three biologically independent experiments are plotted, with error bars representing SDs. Individual data points are shown. Statistical significance was determined comparing GFP-overexpressing with RG1L-overexpressing cells in equal treatment conditions in all panels using one-way ANOVA following log transformation ( ∗ p < 0.05, ∗∗ p < 0.002, ∗∗∗ p < 0.0002, ∗∗∗∗ p < 0.0001; ns, non-significant).

Article Snippet: Proteins were detected by western blotting using the following primary antibodies: actin (rabbit, catalog no. A2103; Sigma-Aldrich), β-actin (mouse, catalog no.sc-47778; Santa Cruz), RABGAP1L (rabbit, catalog no. 13894-1-AP; proteintech), MxA (mouse ab143, kindly provided by Jovan Pavlovic, University of Zurich) , STAT1 (mouse, catalog no. sc-417; Santa Cruz), pSTAT1-Y701 (rabbit, catalog no. 7649S; Cell Signaling), IFI44 (rabbit, catalog no. HPA043858; Atlas Antibodies), FLAG M2 (mouse, catalog no. F1804; Sigma-Aldrich), PB1 (rabbit, catalog no. GTX125923; Genetex), PB2 (rabbit, inhouse), PA (rabbit, catalog no. GTX118991; Genetex), NP (mouse HB65, catalog no. H16-L10-4R5, ATCC), V5 (mouse, catalog no. MCA1360; Bio-Rad), VPS33A (rabbit, catalog no. 16896-1-AP, proteintech), RAB27B (rabbit, catalog no. 13412-1-AP, proteintech), SNF8 (mouse, catalog no. sc-390747, Santa Cruz), A/WSN/33 HA1 (rabbit, catalog no. 11692-T54; Sino Biological) and EEA1 (rabbit, catalog no. 2411, Cell Signaling).

Techniques: Over Expression, Stable Transfection, Expressing, Infection, Luciferase, Activity Assay, Plaque Assay, Transformation Assay

The antiviral function of RABGAP1L relies on its catalytically active TBC domain and residues implicated in endosomal trafficking (A) Schematic representation of RG1L WT and the 421 mutant (RG1L 421) which lacks the C-terminal region downstream of the kin domain. (B) Immunofluorescence analysis of A549 cells stably expressing EV, RG1L WT, or RG1L 421. Cells were fixed and stained with the indicated antibodies. Scale bar represents 25 μm. (C) A549 cells stably expressing GFP, RG1L WT, or RG1L 421 were stimulated with IFNα2 (1,000 U/mL or mock) for 16 h prior to infection with WSN/33 (MOI 0.001 PFU/cell). Supernatants were collected after 48 h and titrated on MDCK cells. (D) Schematic representation of the TBC domain of RABGAP1L and the localization of mutants R584A (R mut ), Q621A (Q mut ), R584A-Q621A (RQ mut ), and KK784EE (KK mut ). KK mut has previously been shown to prevent interaction with the AnkB death domain (DD). (E) Western blot validation of RABGAP1L expression in A549 cells stably expressing RG1L WT or the indicated mutants. (F) Immunofluorescence analysis of cells described in (E) (here, EV was used as a control), fixed and stained with the indicated antibodies. Scale bar represents 25 μm. (G) Cells described in (E) were infected with WSN/33- Renilla (MOI 1 PFU/cell) following treatment with IFNα2 (1,000 U/mL or mock) for 16 h. The AUC was calculated from RLU values taken up to 11 h p.i. For (B), (E), and (F), representative data from three biologically independent experiments are shown. For (C) and (G), mean values from three biologically independent experiments are plotted, with error bars representing SDs. Individual data points are shown. Statistical significance was determined using one-way ANOVA following log transformation ( ∗ p < 0.05, ∗∗ p < 0.002, ∗∗∗∗ p < 0.0001). See also <xref ref-type=Figure S3 . " width="100%" height="100%">

Journal: Cell Reports

Article Title: Restriction factor screening identifies RABGAP1L-mediated disruption of endocytosis as a host antiviral defense

doi: 10.1016/j.celrep.2022.110549

Figure Lengend Snippet: The antiviral function of RABGAP1L relies on its catalytically active TBC domain and residues implicated in endosomal trafficking (A) Schematic representation of RG1L WT and the 421 mutant (RG1L 421) which lacks the C-terminal region downstream of the kin domain. (B) Immunofluorescence analysis of A549 cells stably expressing EV, RG1L WT, or RG1L 421. Cells were fixed and stained with the indicated antibodies. Scale bar represents 25 μm. (C) A549 cells stably expressing GFP, RG1L WT, or RG1L 421 were stimulated with IFNα2 (1,000 U/mL or mock) for 16 h prior to infection with WSN/33 (MOI 0.001 PFU/cell). Supernatants were collected after 48 h and titrated on MDCK cells. (D) Schematic representation of the TBC domain of RABGAP1L and the localization of mutants R584A (R mut ), Q621A (Q mut ), R584A-Q621A (RQ mut ), and KK784EE (KK mut ). KK mut has previously been shown to prevent interaction with the AnkB death domain (DD). (E) Western blot validation of RABGAP1L expression in A549 cells stably expressing RG1L WT or the indicated mutants. (F) Immunofluorescence analysis of cells described in (E) (here, EV was used as a control), fixed and stained with the indicated antibodies. Scale bar represents 25 μm. (G) Cells described in (E) were infected with WSN/33- Renilla (MOI 1 PFU/cell) following treatment with IFNα2 (1,000 U/mL or mock) for 16 h. The AUC was calculated from RLU values taken up to 11 h p.i. For (B), (E), and (F), representative data from three biologically independent experiments are shown. For (C) and (G), mean values from three biologically independent experiments are plotted, with error bars representing SDs. Individual data points are shown. Statistical significance was determined using one-way ANOVA following log transformation ( ∗ p < 0.05, ∗∗ p < 0.002, ∗∗∗∗ p < 0.0001). See also Figure S3 .

Article Snippet: Proteins were detected by western blotting using the following primary antibodies: actin (rabbit, catalog no. A2103; Sigma-Aldrich), β-actin (mouse, catalog no.sc-47778; Santa Cruz), RABGAP1L (rabbit, catalog no. 13894-1-AP; proteintech), MxA (mouse ab143, kindly provided by Jovan Pavlovic, University of Zurich) , STAT1 (mouse, catalog no. sc-417; Santa Cruz), pSTAT1-Y701 (rabbit, catalog no. 7649S; Cell Signaling), IFI44 (rabbit, catalog no. HPA043858; Atlas Antibodies), FLAG M2 (mouse, catalog no. F1804; Sigma-Aldrich), PB1 (rabbit, catalog no. GTX125923; Genetex), PB2 (rabbit, inhouse), PA (rabbit, catalog no. GTX118991; Genetex), NP (mouse HB65, catalog no. H16-L10-4R5, ATCC), V5 (mouse, catalog no. MCA1360; Bio-Rad), VPS33A (rabbit, catalog no. 16896-1-AP, proteintech), RAB27B (rabbit, catalog no. 13412-1-AP, proteintech), SNF8 (mouse, catalog no. sc-390747, Santa Cruz), A/WSN/33 HA1 (rabbit, catalog no. 11692-T54; Sino Biological) and EEA1 (rabbit, catalog no. 2411, Cell Signaling).

Techniques: Mutagenesis, Immunofluorescence, Stable Transfection, Expressing, Staining, Infection, Western Blot, Transformation Assay

Proximity-labeling-based proteomics identifies the RABGAP1L host interactome (A) Schematic representation of TurboID-V5-tagged (T-V5) GFP (negative control) carrying a nuclear-export sequence (NES) or T-V5-tagged RABGAP1L (T-V5-RG1L). (B) Constructs described in (A) were stably expressed in A549 cells, and their expression was validated by immunofluorescence using an α-V5 (red) antibody. Nuclei were stained with DAPI (blue). Scale bar represents 25 μm. (C) Western blot analysis of cells described in (B) compared with A549 cells stably expressing untagged GFP or RABGAP1L (RG1L). Proteins of interest were detected with the indicated antibodies. (D) Cells described in (C) were stimulated with IFNα2 (1,000 U/mL or mock) 16 h prior to infection with WSN/33- Renilla (MOI 1 PFU/cell). The AUC was calculated from RLU values taken up to 11 h p.i. Mean values from three biologically independent experiments are plotted, with error bars representing SDs. Individual data points are shown. (E) Workflow of the TurboID proximity-labeling approach. Cells described in (B) were treated with IFNα2 (1,000 U/mL or mock) for 16 h, followed by treatment with biotin (500 μM) for 15 min. Following streptavidin-based affinity purification, peptides were generated and subjected to mass-spectrometry analyses. (F) Interactors specific to RABGAP1L (as compared to GFP-NES) identified using the protocol described in (E). Hits are listed with their gene names and sorted according to previously described functions. Most hits were identified in non-IFNα2-treated samples. Hits marked with an asterisk ( ∗ ) were identified in the presence and absence of IFNα2, and hits marked in bold were only identified in IFNα2-treated samples. (G) A549 cells stably expressing constructs introduced in (A) or T-V5-tagged RABGAP1L KK mut and RQ mut were subjected to the proximity labeling approach outlined in (E). Following streptavidin-based affinity purification (samples termed “eluates”), total lysates and eluates were analyzed by western blot. Proteins were detected with the indicated antibodies. Data obtained in (B), (C), and (G) are representative of three biologically independent experiments. For (D), statistical significance was determined using one-way ANOVA following log transformation (ns, non-significant). See also and <xref ref-type=Figure S4 . " width="100%" height="100%">

Journal: Cell Reports

Article Title: Restriction factor screening identifies RABGAP1L-mediated disruption of endocytosis as a host antiviral defense

doi: 10.1016/j.celrep.2022.110549

Figure Lengend Snippet: Proximity-labeling-based proteomics identifies the RABGAP1L host interactome (A) Schematic representation of TurboID-V5-tagged (T-V5) GFP (negative control) carrying a nuclear-export sequence (NES) or T-V5-tagged RABGAP1L (T-V5-RG1L). (B) Constructs described in (A) were stably expressed in A549 cells, and their expression was validated by immunofluorescence using an α-V5 (red) antibody. Nuclei were stained with DAPI (blue). Scale bar represents 25 μm. (C) Western blot analysis of cells described in (B) compared with A549 cells stably expressing untagged GFP or RABGAP1L (RG1L). Proteins of interest were detected with the indicated antibodies. (D) Cells described in (C) were stimulated with IFNα2 (1,000 U/mL or mock) 16 h prior to infection with WSN/33- Renilla (MOI 1 PFU/cell). The AUC was calculated from RLU values taken up to 11 h p.i. Mean values from three biologically independent experiments are plotted, with error bars representing SDs. Individual data points are shown. (E) Workflow of the TurboID proximity-labeling approach. Cells described in (B) were treated with IFNα2 (1,000 U/mL or mock) for 16 h, followed by treatment with biotin (500 μM) for 15 min. Following streptavidin-based affinity purification, peptides were generated and subjected to mass-spectrometry analyses. (F) Interactors specific to RABGAP1L (as compared to GFP-NES) identified using the protocol described in (E). Hits are listed with their gene names and sorted according to previously described functions. Most hits were identified in non-IFNα2-treated samples. Hits marked with an asterisk ( ∗ ) were identified in the presence and absence of IFNα2, and hits marked in bold were only identified in IFNα2-treated samples. (G) A549 cells stably expressing constructs introduced in (A) or T-V5-tagged RABGAP1L KK mut and RQ mut were subjected to the proximity labeling approach outlined in (E). Following streptavidin-based affinity purification (samples termed “eluates”), total lysates and eluates were analyzed by western blot. Proteins were detected with the indicated antibodies. Data obtained in (B), (C), and (G) are representative of three biologically independent experiments. For (D), statistical significance was determined using one-way ANOVA following log transformation (ns, non-significant). See also and Figure S4 .

Article Snippet: Proteins were detected by western blotting using the following primary antibodies: actin (rabbit, catalog no. A2103; Sigma-Aldrich), β-actin (mouse, catalog no.sc-47778; Santa Cruz), RABGAP1L (rabbit, catalog no. 13894-1-AP; proteintech), MxA (mouse ab143, kindly provided by Jovan Pavlovic, University of Zurich) , STAT1 (mouse, catalog no. sc-417; Santa Cruz), pSTAT1-Y701 (rabbit, catalog no. 7649S; Cell Signaling), IFI44 (rabbit, catalog no. HPA043858; Atlas Antibodies), FLAG M2 (mouse, catalog no. F1804; Sigma-Aldrich), PB1 (rabbit, catalog no. GTX125923; Genetex), PB2 (rabbit, inhouse), PA (rabbit, catalog no. GTX118991; Genetex), NP (mouse HB65, catalog no. H16-L10-4R5, ATCC), V5 (mouse, catalog no. MCA1360; Bio-Rad), VPS33A (rabbit, catalog no. 16896-1-AP, proteintech), RAB27B (rabbit, catalog no. 13412-1-AP, proteintech), SNF8 (mouse, catalog no. sc-390747, Santa Cruz), A/WSN/33 HA1 (rabbit, catalog no. 11692-T54; Sino Biological) and EEA1 (rabbit, catalog no. 2411, Cell Signaling).

Techniques: Labeling, Negative Control, Sequencing, Construct, Stable Transfection, Expressing, Immunofluorescence, Staining, Western Blot, Infection, Affinity Purification, Generated, Mass Spectrometry, Transformation Assay

RABGAP1L expression impacts host endosomal function and IAV uptake (A–C) A549 cells stably expressing RABGAP1L WT, the 421-truncation mutant, or EV were infected with WSN/33 (MOI 5 PFU/cell) for 1 h on ice. Three hours after incubation at 37°C, cells were fixed and stained with antibodies against RABGAP1L (red) and NP (green) (A). Nuclei were stained with DAPI (blue). Scale bar represents 25 μm. (B and C) Green mean fluorescent intensities (MFIs) of nuclear NP signals were quantified from fluorescent-microscopy images from (A) using ImageJ software. Individual cells are represented by single dots (B). Mean values of data from three biologically independent experiments in (B), normalized to EV, are shown in (C). (D) MDCK cells, expressing the constructs described in (A), were infected for 4 h at 37°C with WSN/33-pseudotyped β-lactamase-matrix protein (BlaM1) fusion protein VLPs prior to quantification of entry-positive cells via flow cytometry. Data represent means, with error bars showing SDs, from three biologically independent experiments. Individual data points are shown. (E) Experimental setup for immunofluorescence-based confocal microscopy to track early stages during IAV entry. Following infection with WSN/33 (MOI 25 PFU/cell or mock) for 1 h at 4°C, cells were fixed at the indicated timepoints. (F) A549 cells stably expressing RABGAP1L (RG1L) or EV were subjected to the experimental setup described in (E). The MFI of HA signals (green) at 0 min p.i. were quantified from confocal-microscopy images shown in <xref ref-type=Figure S6 A using ImageJ. Individual cells are represented by single dots. (G) Quantification of co-localizations between EEA1 and HA from confocal images shown in (H) and Figure S6 A using Imaris. Individual cells are represented by single dots. (H) Immunofluorescence analysis of RABGAP1L or EV-expressing A549 cells treated as described in (E). Cells were stained for early endosomes (EEA1, magenta), viral proteins (HA, green), and nuclei (DAPI, blue). Scale bar represents 25 μm. White arrows indicate co-localizations between EEA1 and HA. Representative images of at least nine analyzed cells per time point from at least two biologically independent experiments. (I) Quantification of co-localizations between EEA1 and HA from confocal images shown in Figure S6 B. Individual cells are represented by single dots. (J and K) Cells described in (A) were serum starved for 2 h prior to treatment with Dynasore (Dyn.; 100 μm) or DMSO for 1 h at 37°C. Cells were then incubated with Alexa-Fluor-488-conjugated transferrin (Tf-488) for 1 h at 4°C followed by a 10-min incubation at 37°C prior to fixation. (J) MFI quantification of Tf-488 signals from confocal-microscopy images shown in (K) using ImageJ software. Individual cells are represented by single dots. (K) Cells were stained with anti-transferrin receptor (TfR) antibody (magenta) and DAPI (blue) prior to analysis by confocal microscopy. Scale bar represents 25 μm. Representative images of at least 25 analyzed cells from two biologically independent experiments. Statistical significance was determined using unpaired nonparametric t test (B, F, G, and J), unpaired one-way ANOVA (C and D), or ordinary two-way ANOVA (I) ( ∗ p < 0.05, ∗∗ p < 0.002, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; ns, non-significant). See also . " width="100%" height="100%">

Journal: Cell Reports

Article Title: Restriction factor screening identifies RABGAP1L-mediated disruption of endocytosis as a host antiviral defense

doi: 10.1016/j.celrep.2022.110549

Figure Lengend Snippet: RABGAP1L expression impacts host endosomal function and IAV uptake (A–C) A549 cells stably expressing RABGAP1L WT, the 421-truncation mutant, or EV were infected with WSN/33 (MOI 5 PFU/cell) for 1 h on ice. Three hours after incubation at 37°C, cells were fixed and stained with antibodies against RABGAP1L (red) and NP (green) (A). Nuclei were stained with DAPI (blue). Scale bar represents 25 μm. (B and C) Green mean fluorescent intensities (MFIs) of nuclear NP signals were quantified from fluorescent-microscopy images from (A) using ImageJ software. Individual cells are represented by single dots (B). Mean values of data from three biologically independent experiments in (B), normalized to EV, are shown in (C). (D) MDCK cells, expressing the constructs described in (A), were infected for 4 h at 37°C with WSN/33-pseudotyped β-lactamase-matrix protein (BlaM1) fusion protein VLPs prior to quantification of entry-positive cells via flow cytometry. Data represent means, with error bars showing SDs, from three biologically independent experiments. Individual data points are shown. (E) Experimental setup for immunofluorescence-based confocal microscopy to track early stages during IAV entry. Following infection with WSN/33 (MOI 25 PFU/cell or mock) for 1 h at 4°C, cells were fixed at the indicated timepoints. (F) A549 cells stably expressing RABGAP1L (RG1L) or EV were subjected to the experimental setup described in (E). The MFI of HA signals (green) at 0 min p.i. were quantified from confocal-microscopy images shown in Figure S6 A using ImageJ. Individual cells are represented by single dots. (G) Quantification of co-localizations between EEA1 and HA from confocal images shown in (H) and Figure S6 A using Imaris. Individual cells are represented by single dots. (H) Immunofluorescence analysis of RABGAP1L or EV-expressing A549 cells treated as described in (E). Cells were stained for early endosomes (EEA1, magenta), viral proteins (HA, green), and nuclei (DAPI, blue). Scale bar represents 25 μm. White arrows indicate co-localizations between EEA1 and HA. Representative images of at least nine analyzed cells per time point from at least two biologically independent experiments. (I) Quantification of co-localizations between EEA1 and HA from confocal images shown in Figure S6 B. Individual cells are represented by single dots. (J and K) Cells described in (A) were serum starved for 2 h prior to treatment with Dynasore (Dyn.; 100 μm) or DMSO for 1 h at 37°C. Cells were then incubated with Alexa-Fluor-488-conjugated transferrin (Tf-488) for 1 h at 4°C followed by a 10-min incubation at 37°C prior to fixation. (J) MFI quantification of Tf-488 signals from confocal-microscopy images shown in (K) using ImageJ software. Individual cells are represented by single dots. (K) Cells were stained with anti-transferrin receptor (TfR) antibody (magenta) and DAPI (blue) prior to analysis by confocal microscopy. Scale bar represents 25 μm. Representative images of at least 25 analyzed cells from two biologically independent experiments. Statistical significance was determined using unpaired nonparametric t test (B, F, G, and J), unpaired one-way ANOVA (C and D), or ordinary two-way ANOVA (I) ( ∗ p < 0.05, ∗∗ p < 0.002, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; ns, non-significant). See also .

Article Snippet: Proteins were detected by western blotting using the following primary antibodies: actin (rabbit, catalog no. A2103; Sigma-Aldrich), β-actin (mouse, catalog no.sc-47778; Santa Cruz), RABGAP1L (rabbit, catalog no. 13894-1-AP; proteintech), MxA (mouse ab143, kindly provided by Jovan Pavlovic, University of Zurich) , STAT1 (mouse, catalog no. sc-417; Santa Cruz), pSTAT1-Y701 (rabbit, catalog no. 7649S; Cell Signaling), IFI44 (rabbit, catalog no. HPA043858; Atlas Antibodies), FLAG M2 (mouse, catalog no. F1804; Sigma-Aldrich), PB1 (rabbit, catalog no. GTX125923; Genetex), PB2 (rabbit, inhouse), PA (rabbit, catalog no. GTX118991; Genetex), NP (mouse HB65, catalog no. H16-L10-4R5, ATCC), V5 (mouse, catalog no. MCA1360; Bio-Rad), VPS33A (rabbit, catalog no. 16896-1-AP, proteintech), RAB27B (rabbit, catalog no. 13412-1-AP, proteintech), SNF8 (mouse, catalog no. sc-390747, Santa Cruz), A/WSN/33 HA1 (rabbit, catalog no. 11692-T54; Sino Biological) and EEA1 (rabbit, catalog no. 2411, Cell Signaling).

Techniques: Expressing, Stable Transfection, Mutagenesis, Infection, Incubation, Staining, Microscopy, Software, Construct, Flow Cytometry, Immunofluorescence, Confocal Microscopy

Journal: Cell Reports

Article Title: Restriction factor screening identifies RABGAP1L-mediated disruption of endocytosis as a host antiviral defense

doi: 10.1016/j.celrep.2022.110549

Figure Lengend Snippet:

Article Snippet: Proteins were detected by western blotting using the following primary antibodies: actin (rabbit, catalog no. A2103; Sigma-Aldrich), β-actin (mouse, catalog no.sc-47778; Santa Cruz), RABGAP1L (rabbit, catalog no. 13894-1-AP; proteintech), MxA (mouse ab143, kindly provided by Jovan Pavlovic, University of Zurich) , STAT1 (mouse, catalog no. sc-417; Santa Cruz), pSTAT1-Y701 (rabbit, catalog no. 7649S; Cell Signaling), IFI44 (rabbit, catalog no. HPA043858; Atlas Antibodies), FLAG M2 (mouse, catalog no. F1804; Sigma-Aldrich), PB1 (rabbit, catalog no. GTX125923; Genetex), PB2 (rabbit, inhouse), PA (rabbit, catalog no. GTX118991; Genetex), NP (mouse HB65, catalog no. H16-L10-4R5, ATCC), V5 (mouse, catalog no. MCA1360; Bio-Rad), VPS33A (rabbit, catalog no. 16896-1-AP, proteintech), RAB27B (rabbit, catalog no. 13412-1-AP, proteintech), SNF8 (mouse, catalog no. sc-390747, Santa Cruz), A/WSN/33 HA1 (rabbit, catalog no. 11692-T54; Sino Biological) and EEA1 (rabbit, catalog no. 2411, Cell Signaling).

Techniques: Recombinant, Transfection, Protease Inhibitor, Magnetic Beads, Electron Microscopy, Cell Viability Assay, Mutagenesis, Clone Assay, Luciferase, Staining, Labeling, Software, Real-time Polymerase Chain Reaction, Imaging, Laser-Scanning Microscopy, Microscopy

Journal: Cell reports

Article Title: APOE4-promoted gliosis and degeneration in tauopathy are ameliorated by pharmacological inhibition of HMGB1 release

doi: 10.1016/j.celrep.2023.113252

Figure Lengend Snippet:

Article Snippet: Donkey anti-mouse Biotin-SP , Jackson Immuno Research Labs , Cat#: 715-065-150; RRID: AB_2307438.

Techniques: Recombinant, Protease Inhibitor, Blocking Assay, Plasmid Preparation, Stripping Membranes, Electron Microscopy, Saline, Avidin-Biotin Assay, Enzyme-linked Immunosorbent Assay, Extraction, Software, Generated, Microscopy, Laser-Scanning Microscopy, Imaging, Spectrophotometry

Early disuse persists synaptic expression of GluA2-lacking AMPARs as changes in synapse numbers on ventral horn neurons and dendritic neuropils after spinal cord injury Overdrive of glutamate AMPARs is known to reflect maladaptive spinal cord plasticity in central nervous system trauma. , (A–E) Workflow diagram of the automated and unbiased high-resolution robotic confocal microscopy. To assess synaptic levels of glutamate AMPARs on dendritic fields and somata of large ventral horn neurons, the randomized microscopic detection and analysis were performed blindly by spinning disk confocal scan system at week 8 post-injury according to the established algorithm. , (A) Fluorescently labeled large ventral horn neurons (diameter >40 μm) indicated presumptive motorneurons and were detected centrally in the sampling window (80 × 80 μm) at 63× magnification. (B) A stack of high-resolution images was taken in the z-plane through a 650 nm filter for presynaptic synaptophysin (upper panel) and a 490 nm filter for postsynaptic AMPARs (lower panel) at each level separately (scale bar: 20 μm). (C) Scanned confocal z stacks were deblurred by 3-D blind iterative deconvolution, and then the total expression of synaptic colocalized AMPAR puncta was quantified using the established approach. (D) Single optical planes showing maximal synaptic colocalization of presynaptic synaptophysin and postsynaptic AMPARs on the somata were selected among the z stacks, and then the optical fraction images of the somatic membrane were generated to assess the synaptic AMPAR expression on the plasma membrane (left panel). Representative optical detection of the presynaptic vesicle, postsynaptic AMPAR subunit, and synaptic colocalization (white arrows) are shown in the enlarged image of the boxed region from the plasma membrane image (right panel; see <xref ref-type=Figure 5 ). (E) Schematic overview on synaptic colocalization of AMPAR subunits GluA1 and GluA2. The overlapping of presynaptic synaptophysin (magenta) and synaptic AMPAR subunit (GluA1 or GluA2; green) puncta indicates synaptic colocalization (white). (F) Representative merged 3-D confocal image of large ventral horn neurons showed postsynaptic GluA1 (green) and synaptophysin (magenta) positive presynaptic terminals on the soma with surrounding dendritic neuropils in the control subject (left panel). The enlarged image of the boxed region from (F, left panel) demonstrates relatively few synaptic colocalized GluA1 puncta (lower right panel, white) within the merge image (upper right panel) in the control subject. (G) Representative merged motorneuron from the early disuse subject demonstrating greater numbers of membrane and dendritic GluA1 colocalized to the synapses (left panel). The enlargement of the boxed region from (G, left panel) demonstrates high levels of synaptic colocalized GluA1 puncta (lower right panel, white) within the merge image (upper right panel) in the early disuse subject. Representative images of synaptic GluA2 puncta are shown in Figure S8 . (H) Quantification of synaptic colocalized AMPAR expression with synaptophysin though the confocal z stacks in the early disuse group ( n = 5; total 164 cells, total 11,971 optical planes for GluA1; total 138 cells, total 9,788 planes for GluA2) compared to the control group ( n = 6; total 163 cells, total 13,037 images for GluA1; total 156 cells, total 10,894 optical planes for GluA2) on the somata and dendritic neuropil. Random effects ANOVA controlling for non-independence of within-subject and within-section variability confirmed that early disuse significantly increased in synaptic colocalization of GluA1 (effect of early disuse condition: F (1,9) = 8.05, ∗ p = 0.019) but no significant difference in synaptic colocalization of GluA2 (effect of early disuse condition: F (1,9) = 0.074, p = 0.792). There was a non-significantly difference between both groups in the presynaptic synaptophysin and postsynaptic AMPAR subunit ( Figure S8 ). Representative examples reflect the group median. ∗ p < 0.05 by one-way ANOVA. All data are shown as means ± SEM. Scale bars in the lower magnification images represent 20 μm, and the scale bar in the higher magnification image represents 5 μm. " width="100%" height="100%">

Journal: iScience

Article Title: Disuse plasticity limits spinal cord injury recovery

doi: 10.1016/j.isci.2025.112180

Figure Lengend Snippet: Early disuse persists synaptic expression of GluA2-lacking AMPARs as changes in synapse numbers on ventral horn neurons and dendritic neuropils after spinal cord injury Overdrive of glutamate AMPARs is known to reflect maladaptive spinal cord plasticity in central nervous system trauma. , (A–E) Workflow diagram of the automated and unbiased high-resolution robotic confocal microscopy. To assess synaptic levels of glutamate AMPARs on dendritic fields and somata of large ventral horn neurons, the randomized microscopic detection and analysis were performed blindly by spinning disk confocal scan system at week 8 post-injury according to the established algorithm. , (A) Fluorescently labeled large ventral horn neurons (diameter >40 μm) indicated presumptive motorneurons and were detected centrally in the sampling window (80 × 80 μm) at 63× magnification. (B) A stack of high-resolution images was taken in the z-plane through a 650 nm filter for presynaptic synaptophysin (upper panel) and a 490 nm filter for postsynaptic AMPARs (lower panel) at each level separately (scale bar: 20 μm). (C) Scanned confocal z stacks were deblurred by 3-D blind iterative deconvolution, and then the total expression of synaptic colocalized AMPAR puncta was quantified using the established approach. (D) Single optical planes showing maximal synaptic colocalization of presynaptic synaptophysin and postsynaptic AMPARs on the somata were selected among the z stacks, and then the optical fraction images of the somatic membrane were generated to assess the synaptic AMPAR expression on the plasma membrane (left panel). Representative optical detection of the presynaptic vesicle, postsynaptic AMPAR subunit, and synaptic colocalization (white arrows) are shown in the enlarged image of the boxed region from the plasma membrane image (right panel; see Figure 5 ). (E) Schematic overview on synaptic colocalization of AMPAR subunits GluA1 and GluA2. The overlapping of presynaptic synaptophysin (magenta) and synaptic AMPAR subunit (GluA1 or GluA2; green) puncta indicates synaptic colocalization (white). (F) Representative merged 3-D confocal image of large ventral horn neurons showed postsynaptic GluA1 (green) and synaptophysin (magenta) positive presynaptic terminals on the soma with surrounding dendritic neuropils in the control subject (left panel). The enlarged image of the boxed region from (F, left panel) demonstrates relatively few synaptic colocalized GluA1 puncta (lower right panel, white) within the merge image (upper right panel) in the control subject. (G) Representative merged motorneuron from the early disuse subject demonstrating greater numbers of membrane and dendritic GluA1 colocalized to the synapses (left panel). The enlargement of the boxed region from (G, left panel) demonstrates high levels of synaptic colocalized GluA1 puncta (lower right panel, white) within the merge image (upper right panel) in the early disuse subject. Representative images of synaptic GluA2 puncta are shown in Figure S8 . (H) Quantification of synaptic colocalized AMPAR expression with synaptophysin though the confocal z stacks in the early disuse group ( n = 5; total 164 cells, total 11,971 optical planes for GluA1; total 138 cells, total 9,788 planes for GluA2) compared to the control group ( n = 6; total 163 cells, total 13,037 images for GluA1; total 156 cells, total 10,894 optical planes for GluA2) on the somata and dendritic neuropil. Random effects ANOVA controlling for non-independence of within-subject and within-section variability confirmed that early disuse significantly increased in synaptic colocalization of GluA1 (effect of early disuse condition: F (1,9) = 8.05, ∗ p = 0.019) but no significant difference in synaptic colocalization of GluA2 (effect of early disuse condition: F (1,9) = 0.074, p = 0.792). There was a non-significantly difference between both groups in the presynaptic synaptophysin and postsynaptic AMPAR subunit ( Figure S8 ). Representative examples reflect the group median. ∗ p < 0.05 by one-way ANOVA. All data are shown as means ± SEM. Scale bars in the lower magnification images represent 20 μm, and the scale bar in the higher magnification image represents 5 μm.

Article Snippet: Slides were washed repeatedly with PBS and then coverslipped with Vectashield mounting medium with DAPI (Vector Laboratories, Burlingame, CA). (2) Confocal image acquisition and 3-D blind iterative image deconvolution All images were acquired at the UCSF Nikon Imaging Center using a Ti inverted microscope (Nikon Instruments, Melville, NY) with a spinning disk confocal scan system (CSU-22; Yokogawa Corporation, Sugar Land, TX) and a Plan Apo VC 63× oil immersion objective with 1.4 numerical aperture (Nikon Instruments), electron multiplying CCD camera running a custom instance of NIS elements imaging software (Nikon Instruments).

Techniques: Expressing, Confocal Microscopy, Labeling, Sampling, Membrane, Generated, Clinical Proteomics, Control

Journal: iScience

Article Title: Disuse plasticity limits spinal cord injury recovery

doi: 10.1016/j.isci.2025.112180

Figure Lengend Snippet:

Article Snippet: Slides were washed repeatedly with PBS and then coverslipped with Vectashield mounting medium with DAPI (Vector Laboratories, Burlingame, CA). (2) Confocal image acquisition and 3-D blind iterative image deconvolution All images were acquired at the UCSF Nikon Imaging Center using a Ti inverted microscope (Nikon Instruments, Melville, NY) with a spinning disk confocal scan system (CSU-22; Yokogawa Corporation, Sugar Land, TX) and a Plan Apo VC 63× oil immersion objective with 1.4 numerical aperture (Nikon Instruments), electron multiplying CCD camera running a custom instance of NIS elements imaging software (Nikon Instruments).

Techniques: Recombinant, Protease Inhibitor, Blocking Assay, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Bicinchoninic Acid Protein Assay, Software, Imaging, Inverted Microscopy, Microscopy

Classification of MEG3 -ON and MEG3 -OFF human embryonic stem cells (hESCs) by detecting the expression of the DLK1-DIO3 locus-derived non-coding RNAs (ncRNAs). (A) The DLK1-DIO3 imprinted locus, which is highly conserved between mice and humans, including clusters of maternally expressed functional ncRNAs, which are marked in red. The human homologs of the Gtl2 and Rian mice genes are MEG3 and MEG8 , respectively. Lollipops with closed circles represent methylated CpG regions, and open circles represent unmethylated CpG regions. Mat, maternal chromosome; Pat, paternal chromosome. (B) The hESCs with high expression levels of imprinted long non-coding RNAs (lncRNAs) ( MEG3 and MEG8 ) and of several imprinted microRNAs (miRNAs) from the DLK1-DIO3 locus (miR-127-3p, miR-154, miR-376c, miR-495, miR-494, and miR-496) were classified as MEG3 -ON hESCs. The hESCs without detectable MEG3 expression accompanied by significant repression of other ncRNAs from the same locus were classified as MEG3 -OFF hESCs. GAPDH was used as an internal control for mRNA expression analysis, and RNU48 was used as an internal control for miRNA expression analysis. The quantitation of lncRNA and miRNA expression was performed by using the 2 −ΔΔCp method. Error bars represent the standard error of the mean generated from three biological repeats. ** P <0.01 with respective MEG3 -ON groups by Student’s t test. DLK1-DIO3 , delta-like homolog 1 gene and the type III iodothyronine deiodinase gene; Gtl2 , gene trap locus 2; IG-DMR, intergenic differentially methylated region; MEG3 , maternally expressed gene 3; N.D., not detectable.

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: Classification of MEG3 -ON and MEG3 -OFF human embryonic stem cells (hESCs) by detecting the expression of the DLK1-DIO3 locus-derived non-coding RNAs (ncRNAs). (A) The DLK1-DIO3 imprinted locus, which is highly conserved between mice and humans, including clusters of maternally expressed functional ncRNAs, which are marked in red. The human homologs of the Gtl2 and Rian mice genes are MEG3 and MEG8 , respectively. Lollipops with closed circles represent methylated CpG regions, and open circles represent unmethylated CpG regions. Mat, maternal chromosome; Pat, paternal chromosome. (B) The hESCs with high expression levels of imprinted long non-coding RNAs (lncRNAs) ( MEG3 and MEG8 ) and of several imprinted microRNAs (miRNAs) from the DLK1-DIO3 locus (miR-127-3p, miR-154, miR-376c, miR-495, miR-494, and miR-496) were classified as MEG3 -ON hESCs. The hESCs without detectable MEG3 expression accompanied by significant repression of other ncRNAs from the same locus were classified as MEG3 -OFF hESCs. GAPDH was used as an internal control for mRNA expression analysis, and RNU48 was used as an internal control for miRNA expression analysis. The quantitation of lncRNA and miRNA expression was performed by using the 2 −ΔΔCp method. Error bars represent the standard error of the mean generated from three biological repeats. ** P <0.01 with respective MEG3 -ON groups by Student’s t test. DLK1-DIO3 , delta-like homolog 1 gene and the type III iodothyronine deiodinase gene; Gtl2 , gene trap locus 2; IG-DMR, intergenic differentially methylated region; MEG3 , maternally expressed gene 3; N.D., not detectable.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Expressing, Derivative Assay, Functional Assay, Methylation, Quantitation Assay, Generated

Twelve - day-old embryoid bodies (EBs) differentiated from MEG3 -OFF human embryonic stem cells (hESCs) displayed abnormal morphologies and expression levels of developmentally regulated genes. (A) Day 12 EBs that were differentiated from MEG3 -OFF NTU1 hESCs were smaller and not well bordered in structure than EBs differentiated from MEG3 -ON NTU1 hESCs. Scale bars, 1,000 μm. The bar chart illustrated the differences in diameters of the 12-day-old EBs derived from MEG3 -ON and MEG3 -OFF hESC sublines. Error bars represent the standard error of the mean (SEM) generated from three biological samples with 20 to 40 EBs in each group. ** P <0.01 with respective MEG3 -ON groups by Student’s t test . (B) Day 12 EBs differentiated from MEG3 -OFF hESCs displayed unusual expression levels of developmentally regulated genes, including higher expression levels of endoderm- and mesoderm-related genes ( SOX17 and HAND1 , respectively) and low but detectable expression levels of an ectoderm-related gene ( PAX6 ). ‘d’ represents the day of EB formation. GAPDH was used as an internal control for mRNA expression analysis. The quantitation of mRNA expression was performed by using the 2 −ΔΔCp method. Error bars represent the SEM generated from three biological samples with three technical repeats each. ** P <0.01 compared with the corresponding MEG3 -ON groups by Student’s t test. MEG3 , maternally expressed gene 3.

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: Twelve - day-old embryoid bodies (EBs) differentiated from MEG3 -OFF human embryonic stem cells (hESCs) displayed abnormal morphologies and expression levels of developmentally regulated genes. (A) Day 12 EBs that were differentiated from MEG3 -OFF NTU1 hESCs were smaller and not well bordered in structure than EBs differentiated from MEG3 -ON NTU1 hESCs. Scale bars, 1,000 μm. The bar chart illustrated the differences in diameters of the 12-day-old EBs derived from MEG3 -ON and MEG3 -OFF hESC sublines. Error bars represent the standard error of the mean (SEM) generated from three biological samples with 20 to 40 EBs in each group. ** P <0.01 with respective MEG3 -ON groups by Student’s t test . (B) Day 12 EBs differentiated from MEG3 -OFF hESCs displayed unusual expression levels of developmentally regulated genes, including higher expression levels of endoderm- and mesoderm-related genes ( SOX17 and HAND1 , respectively) and low but detectable expression levels of an ectoderm-related gene ( PAX6 ). ‘d’ represents the day of EB formation. GAPDH was used as an internal control for mRNA expression analysis. The quantitation of mRNA expression was performed by using the 2 −ΔΔCp method. Error bars represent the SEM generated from three biological samples with three technical repeats each. ** P <0.01 compared with the corresponding MEG3 -ON groups by Student’s t test. MEG3 , maternally expressed gene 3.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Expressing, Derivative Assay, Generated, Quantitation Assay

MEG3 -OFF human embryonic stem cells (hESCs) displayed different transcriptome profiles, particularly in genes related to neural lineage. (A) In total, 114 genes displayed significant differential expression between MEG3 -ON and MEG3 -OFF hESCs. The embryoid body (EB) sample differentiated from ‘ MEG3 -ON’ hESCs was used as a reference for differentiated hESCs. The heatmap represents the most significant differentially expressed genes selected by the intersection indicated by Welch’s t test ( P <0.05; fold change >1.5) and significance analysis of microarrays (SAM) (false discovery rate <0.05). The heatmap displays differentially expressed genes that can be used to distinguish between the MEG3 -ON and MEG3 -OFF cell states. The green-to-red colors of the heatmap are linearly mapped to the Z-scores, which range from −3 to 3. (B) MEG3 -ON and MEG3 -OFF hESCs showed differences in the expression levels of many genes that correlate with neural lineage development and with different tumor types. This analysis was performed by using MetaCore software (GeneGo), which includes developmental processes 1,317 Gene Ontology (GO) terms in Biological Process for GO process testing and literature-based biomarkers of clinical diseases for GO disease testing. (C) A partial gene list of subset of genes related to ‘nervous system development (GO:0007399)’ was clearly shown to be differentially expressed between undifferentiated MEG3 -ON and MEG3 -OFF hESCs by using GSEA. In this heatmap, expression values are represented as colors, with the range of colors (red, pink, light blue, and dark blue) indicating the range of expression values (high, moderate, low, and lowest, respectively). MEG3 , maternally expressed gene 3.

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: MEG3 -OFF human embryonic stem cells (hESCs) displayed different transcriptome profiles, particularly in genes related to neural lineage. (A) In total, 114 genes displayed significant differential expression between MEG3 -ON and MEG3 -OFF hESCs. The embryoid body (EB) sample differentiated from ‘ MEG3 -ON’ hESCs was used as a reference for differentiated hESCs. The heatmap represents the most significant differentially expressed genes selected by the intersection indicated by Welch’s t test ( P <0.05; fold change >1.5) and significance analysis of microarrays (SAM) (false discovery rate <0.05). The heatmap displays differentially expressed genes that can be used to distinguish between the MEG3 -ON and MEG3 -OFF cell states. The green-to-red colors of the heatmap are linearly mapped to the Z-scores, which range from −3 to 3. (B) MEG3 -ON and MEG3 -OFF hESCs showed differences in the expression levels of many genes that correlate with neural lineage development and with different tumor types. This analysis was performed by using MetaCore software (GeneGo), which includes developmental processes 1,317 Gene Ontology (GO) terms in Biological Process for GO process testing and literature-based biomarkers of clinical diseases for GO disease testing. (C) A partial gene list of subset of genes related to ‘nervous system development (GO:0007399)’ was clearly shown to be differentially expressed between undifferentiated MEG3 -ON and MEG3 -OFF hESCs by using GSEA. In this heatmap, expression values are represented as colors, with the range of colors (red, pink, light blue, and dark blue) indicating the range of expression values (high, moderate, low, and lowest, respectively). MEG3 , maternally expressed gene 3.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Expressing, Software

Associations between the expression of MEG3 and neural lineage genes in human embryonic stem cell (hESC) and human induced pluripotent stem cell (hiPSC) lines. (A) Repression of MEG3 was consistently correlated with downregulation of PAX6 , RTN1 , and DLK1 in various cell lines. The cell lines where MEG3 was not detectable, including NTU1, NTU3, H9, and iPSC lines, also displayed lower expression levels of PAX6 , RTN1 , and DLK1 . The mRNA expression was quantified with the 2 −ΔΔCp method (using GAPDH for normalization). In the NTU1 and NTU3 hESC lines, error bars represent the standard error of the mean (SEM) generated from three biological repeats. In the H9 hESC line and the two iPSC lines, error bars represent the SEM generated from one biological sample with three technical repeats. * P <0.05, ** P <0.01 with the corresponding MEG3 -ON groups by Student’s t test . N.D., not detectable. (B) MEG3 knockdown assays were conducted via small hairpin RNA (shRNA) and small interfering RNA (siRNA) to examine the association between MEG3 reduction and the expression levels of neural lineage-related genes in NTU1 hESCs. In the sh- MEG3 group with MEG3 reduction, PAX6 , RTN1 , and DLK1 showed downregulated expression (upper panel) compared with the scramble control. PAX6 and RTN1 were also downregulated in two si- MEG3 -treated groups with reduced MEG3 expression, whereas DLK1 was reduced in one siRNA-treated group compared with the scramble control (lower panel). The mRNA expression was quantified with the 2 −ΔΔCp method (using GAPDH for normalization). Error bars represent the SEM generated from one biological sample with three technical repeats each. * P <0.05, ** P <0.01 with the corresponding scramble control groups by Student’s t test in shRNA experiments; one-way analysis of variance and Dunnett’s multiple comparisons test were used in siRNA experiments, with significance defined as * P <0.05 and ** P <0.01. MEG3 , maternally expressed gene 3.

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: Associations between the expression of MEG3 and neural lineage genes in human embryonic stem cell (hESC) and human induced pluripotent stem cell (hiPSC) lines. (A) Repression of MEG3 was consistently correlated with downregulation of PAX6 , RTN1 , and DLK1 in various cell lines. The cell lines where MEG3 was not detectable, including NTU1, NTU3, H9, and iPSC lines, also displayed lower expression levels of PAX6 , RTN1 , and DLK1 . The mRNA expression was quantified with the 2 −ΔΔCp method (using GAPDH for normalization). In the NTU1 and NTU3 hESC lines, error bars represent the standard error of the mean (SEM) generated from three biological repeats. In the H9 hESC line and the two iPSC lines, error bars represent the SEM generated from one biological sample with three technical repeats. * P <0.05, ** P <0.01 with the corresponding MEG3 -ON groups by Student’s t test . N.D., not detectable. (B) MEG3 knockdown assays were conducted via small hairpin RNA (shRNA) and small interfering RNA (siRNA) to examine the association between MEG3 reduction and the expression levels of neural lineage-related genes in NTU1 hESCs. In the sh- MEG3 group with MEG3 reduction, PAX6 , RTN1 , and DLK1 showed downregulated expression (upper panel) compared with the scramble control. PAX6 and RTN1 were also downregulated in two si- MEG3 -treated groups with reduced MEG3 expression, whereas DLK1 was reduced in one siRNA-treated group compared with the scramble control (lower panel). The mRNA expression was quantified with the 2 −ΔΔCp method (using GAPDH for normalization). Error bars represent the SEM generated from one biological sample with three technical repeats each. * P <0.05, ** P <0.01 with the corresponding scramble control groups by Student’s t test in shRNA experiments; one-way analysis of variance and Dunnett’s multiple comparisons test were used in siRNA experiments, with significance defined as * P <0.05 and ** P <0.01. MEG3 , maternally expressed gene 3.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Expressing, Generated, shRNA, Small Interfering RNA

Neural markers were differentially expressed between MEG3 -ON and MEG3 -OFF human embryonic stem cell (hESC)-differentiated cells during neural lineage differentiation. (A) Neural lineage differentiation was conducted from the undifferentiated stage to the 18 day-Matrigel attachment stage in NTU1 and NTU3 hESC lines. (B) Expression levels of stage-specific markers were analyzed by quantitative reverse transcription-polymerase chain reaction in MEG3 -ON and MEG3 -OFF groups during differentiation. The quantitation of mRNA expression was performed by using the 2 −ΔΔCp method (using the housekeeping gene GAPDH for normalization). Error bars represent the standard error of the mean generated from three biological samples with three technical repeats each. * P <0.05, ** P <0.01 compared with the respective MEG3 -ON groups by Student’s t test. MEG3 , maternally expressed gene 3; NES, neuroectodermal sphere.

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: Neural markers were differentially expressed between MEG3 -ON and MEG3 -OFF human embryonic stem cell (hESC)-differentiated cells during neural lineage differentiation. (A) Neural lineage differentiation was conducted from the undifferentiated stage to the 18 day-Matrigel attachment stage in NTU1 and NTU3 hESC lines. (B) Expression levels of stage-specific markers were analyzed by quantitative reverse transcription-polymerase chain reaction in MEG3 -ON and MEG3 -OFF groups during differentiation. The quantitation of mRNA expression was performed by using the 2 −ΔΔCp method (using the housekeeping gene GAPDH for normalization). Error bars represent the standard error of the mean generated from three biological samples with three technical repeats each. * P <0.05, ** P <0.01 compared with the respective MEG3 -ON groups by Student’s t test. MEG3 , maternally expressed gene 3; NES, neuroectodermal sphere.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Quantitation Assay, Generated

Neurite formation was reduced in MEG3 -OFF human embryonic stem cell (hESC)-differentiated cells compared with cells differentiated from MEG3 -ON hESCs. Immunofluorescent staining was performed with anti-beta-III Tubulin and anti-MAP2 antibodies to examine neurite formation in cells derived from MEG3 -ON and MEG3 -OFF hESCs of the NTU1 (A) and NTU3 (B) cell lines after 18 days of differentiation on Matrigel. Scale bars, 100 μm. MEG3 , maternally expressed gene 3.

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: Neurite formation was reduced in MEG3 -OFF human embryonic stem cell (hESC)-differentiated cells compared with cells differentiated from MEG3 -ON hESCs. Immunofluorescent staining was performed with anti-beta-III Tubulin and anti-MAP2 antibodies to examine neurite formation in cells derived from MEG3 -ON and MEG3 -OFF hESCs of the NTU1 (A) and NTU3 (B) cell lines after 18 days of differentiation on Matrigel. Scale bars, 100 μm. MEG3 , maternally expressed gene 3.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Staining, Derivative Assay

NCKAP1 is associated with impaired phagocytic function in ALS(R)-iMGs. Transcriptome analysis of iMGs generated from three ALS(R) and four ALS(S) patients. a Principal component analysis (PCA) of all expressed genes in individual ALS(R)-iMGs and ALS(S)-iMGs. b Venn diagram illustrating that the number and overlap of transcripts differed significantly in the two groups according to RNA-seq (1.5-fold-change). c Functional analysis using DAVID software from 2559 transcripts that were significantly altered in ALS(R)-iMGs compared to ALS(S)-iMGs (10 GO analyses). The number within each bar indicates the number of genes in the database for the specified term. d Volcano plot showing transcripts with significantly altered abundance in ALS(R)-iMGs compared to ALS(S)-iMGs. We tested for significant differences between ALS(R)-iMGs and ALS(S)-iMGs samples, which are highlighted, using a cutoff of P values of 0.05 with a 1.5-fold-change ratio cutoff. GO genes of phagocytosis (GO: 0,006,909) are presented. e A subset of 13 transcripts identified as “hits” (phagocytosis-related increased or decreased abundance) in ALS(R)-iMGs compared to ALS(S)-iMGs were validated by RT-qPCR. f NCKAP1 mRNA expression in individual-subject-derived monocytes or iMGs from the two groups. The symbols represent individual-subject-derived monocytes or iMGs (ALS(R): n = 5; ALS(S): n = 8, from available samples) g Correlation of the relative expression of NCKAP1 in iMGs with the rate of disease progression from the symptom onset time to the sampling time point for the generation of iMGs (∆FS, points/month). Values are means ± SEM. Comparisons were made against control (* P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, ns, not significant; unpaired t test or two-way ANOVA with post hoc Tukey’s tests)

Journal: Molecular Neurobiology

Article Title: Role of NCKAP1 in the Defective Phagocytic Function of Microglia-Like Cells Derived from Rapidly Progressing Sporadic ALS

doi: 10.1007/s12035-023-03339-2

Figure Lengend Snippet: NCKAP1 is associated with impaired phagocytic function in ALS(R)-iMGs. Transcriptome analysis of iMGs generated from three ALS(R) and four ALS(S) patients. a Principal component analysis (PCA) of all expressed genes in individual ALS(R)-iMGs and ALS(S)-iMGs. b Venn diagram illustrating that the number and overlap of transcripts differed significantly in the two groups according to RNA-seq (1.5-fold-change). c Functional analysis using DAVID software from 2559 transcripts that were significantly altered in ALS(R)-iMGs compared to ALS(S)-iMGs (10 GO analyses). The number within each bar indicates the number of genes in the database for the specified term. d Volcano plot showing transcripts with significantly altered abundance in ALS(R)-iMGs compared to ALS(S)-iMGs. We tested for significant differences between ALS(R)-iMGs and ALS(S)-iMGs samples, which are highlighted, using a cutoff of P values of 0.05 with a 1.5-fold-change ratio cutoff. GO genes of phagocytosis (GO: 0,006,909) are presented. e A subset of 13 transcripts identified as “hits” (phagocytosis-related increased or decreased abundance) in ALS(R)-iMGs compared to ALS(S)-iMGs were validated by RT-qPCR. f NCKAP1 mRNA expression in individual-subject-derived monocytes or iMGs from the two groups. The symbols represent individual-subject-derived monocytes or iMGs (ALS(R): n = 5; ALS(S): n = 8, from available samples) g Correlation of the relative expression of NCKAP1 in iMGs with the rate of disease progression from the symptom onset time to the sampling time point for the generation of iMGs (∆FS, points/month). Values are means ± SEM. Comparisons were made against control (* P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, ns, not significant; unpaired t test or two-way ANOVA with post hoc Tukey’s tests)

Article Snippet: HeLa cells were transfected with green fluorescent protein (GFP)-tagged human NCKAP1 cDNA or NCKAP1 shRNA using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. iMGs were transduced with pLenti-C-mGFP-Human NCKAP1 (NM_013436), the cDNA ORF Clone (OriGene Technologies, Rockville, MD, USA), or pGFP-C-shLenti-NCKAP1 Human shRNA lentiviral particles (ID 10,787) according to the manufacturer’s protocol.

Techniques: Generated, RNA Sequencing, Functional Assay, Software, Quantitative RT-PCR, Expressing, Derivative Assay, Biomarker Discovery, Sampling, Control

NCKAP1 regulates genes involved in actin polymerization and overexpression of NCKAP1 rescues defective phagocytic function in ALS(R)-iMGs. a , b Subcellular distribution of actin polymerization-related proteins (members of WAVE complex) and NCKAP1 during bead phagocytosis in both groups of ALS-iMGs (ALS(S)-iMGs and ALS(R)-iMGs). In ALS(S)-iMGs, WAVE (yellow; a ) and ABI (yellow; b ) were markedly accumulated at the phagocytic cups along with NCKAP1 (green), phalloidin (red; F-actin marker), and DAPI counterstain (blue). Arrows indicate phagocytic cups surrounding a bead. The figure is representative of independent experiments performed in replicates ( n = 10). Scale bar: 25 μm. c Human NCKAP1 or shNCKAP1 was transfected into HeLa cells and changes in the expression of actin polymerization-related genes such as CYFIP1, ABI2, WAVE1, and WAVE2 were examined by western blot. An empty shRNA vector was used as a control (scramble-shRNA). * represents NCKAP1-GFP. d Quantification of the mRNA expression level of each normalized to GAPDH and indicated as relative expression of vehicle control ( n = 3). Values are means ± SEM. Comparisons were made against control (* P < 0.05, ** P < 0.01, *** P < 0.001; two-way ANOVA with post hoc Tukey’s tests). e , f Snapshots of live cell imaging showing phagocytosis of latex beads in both groups of ALS-iMGs. Merged images of DIC (latex bead) and fluorescence images (F-actin: red; DAPI: blue). ALS(S)-iMGs (upper) showed normal phagocytic function, whereas ALS(R)-iMGs (lower) showed a marked impairment in phagocytosis ( e ). Latex bead phagocytosis in ALS(S)-iMGs transfected with shNCKAP1-GFP (upper) or ALS(R)-iMGs transfected with NCKAP1-GFP (lower) ( f ). The impaired phagocytic function in ALS(R)-iMGs was rescued by NCKAP1 overexpression. Representative frames from a time-lapse image series (0 – 5 h) are shown. The figure is representative of independent experiments performed in replicates ( n = 10). Scale bar: 25 μm

Journal: Molecular Neurobiology

Article Title: Role of NCKAP1 in the Defective Phagocytic Function of Microglia-Like Cells Derived from Rapidly Progressing Sporadic ALS

doi: 10.1007/s12035-023-03339-2

Figure Lengend Snippet: NCKAP1 regulates genes involved in actin polymerization and overexpression of NCKAP1 rescues defective phagocytic function in ALS(R)-iMGs. a , b Subcellular distribution of actin polymerization-related proteins (members of WAVE complex) and NCKAP1 during bead phagocytosis in both groups of ALS-iMGs (ALS(S)-iMGs and ALS(R)-iMGs). In ALS(S)-iMGs, WAVE (yellow; a ) and ABI (yellow; b ) were markedly accumulated at the phagocytic cups along with NCKAP1 (green), phalloidin (red; F-actin marker), and DAPI counterstain (blue). Arrows indicate phagocytic cups surrounding a bead. The figure is representative of independent experiments performed in replicates ( n = 10). Scale bar: 25 μm. c Human NCKAP1 or shNCKAP1 was transfected into HeLa cells and changes in the expression of actin polymerization-related genes such as CYFIP1, ABI2, WAVE1, and WAVE2 were examined by western blot. An empty shRNA vector was used as a control (scramble-shRNA). * represents NCKAP1-GFP. d Quantification of the mRNA expression level of each normalized to GAPDH and indicated as relative expression of vehicle control ( n = 3). Values are means ± SEM. Comparisons were made against control (* P < 0.05, ** P < 0.01, *** P < 0.001; two-way ANOVA with post hoc Tukey’s tests). e , f Snapshots of live cell imaging showing phagocytosis of latex beads in both groups of ALS-iMGs. Merged images of DIC (latex bead) and fluorescence images (F-actin: red; DAPI: blue). ALS(S)-iMGs (upper) showed normal phagocytic function, whereas ALS(R)-iMGs (lower) showed a marked impairment in phagocytosis ( e ). Latex bead phagocytosis in ALS(S)-iMGs transfected with shNCKAP1-GFP (upper) or ALS(R)-iMGs transfected with NCKAP1-GFP (lower) ( f ). The impaired phagocytic function in ALS(R)-iMGs was rescued by NCKAP1 overexpression. Representative frames from a time-lapse image series (0 – 5 h) are shown. The figure is representative of independent experiments performed in replicates ( n = 10). Scale bar: 25 μm

Article Snippet: HeLa cells were transfected with green fluorescent protein (GFP)-tagged human NCKAP1 cDNA or NCKAP1 shRNA using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. iMGs were transduced with pLenti-C-mGFP-Human NCKAP1 (NM_013436), the cDNA ORF Clone (OriGene Technologies, Rockville, MD, USA), or pGFP-C-shLenti-NCKAP1 Human shRNA lentiviral particles (ID 10,787) according to the manufacturer’s protocol.

Techniques: Over Expression, Marker, Transfection, Expressing, Western Blot, shRNA, Plasmid Preparation, Control, Live Cell Imaging, Fluorescence

FLNA inhibits TFAP2A expression in both SaOS2 and HeLa cells. A and B , effect of FLNA silencing on TFAP2A mRNA expression was analyzed using the mRNA-Seq data obtained from SaOS2 cell lines expressing control shRNA or FLNA shRNA. TFAP2A mRNA reads from three biological replicates and the log 2 fold change are presented in A and B , respectively. Log 2 fold change was obtained by comparing the mean of TFAP2A mRNA reads from FLNA shRNA samples with that from Ctrl shRNA samples. C and D , effect of FLNA knockdown on TFAP2A expression in SaOS2 cells; RT-qPCR ( C ) and Western blot ( D ) were performed using SaOS2 cells stably expressing control shRNA or FLNA shRNA. E and F , effect of FLNA knockdown on TFAP2A expression in HeLa cells. RT-qPCR ( E ) and Western blot ( F ) were performed using HeLa cell lines stably expressing control shRNA or FLNA shRNA. G and H , effect of FLNA overexpression on TFAP2A expression in HeLa cells. A HeLa cell line stably expressing HA-FLNA and its control cell line (empty vector) were used to extract total RNA. TFAP2A mRNA expression was analyzed by RT-qPCR using the cDNA synthesized from the total RNA ( G ). TFAP2A protein expression was detected by Western blot using the total cell lysate of these cell lines and the antibodies against the factors as indicated ( H ). I , expression of TFAP2A in SaOS2, 293T, and HeLa cells was analyzed by Western blot. Each column in histograms represents the mean ± SD of three biological replicates. ∗ p < 0.05; ∗∗ p < 0.01. p values were obtained by Student’s t test. RT-qPCR, reverse transcription–quantitative polymerase chain reaction.

Journal: The Journal of Biological Chemistry

Article Title: Transcription factor AP-2α activates RNA polymerase III–directed transcription and tumor cell proliferation by controlling expression of c-MYC and p53

doi: 10.1016/j.jbc.2023.102945

Figure Lengend Snippet: FLNA inhibits TFAP2A expression in both SaOS2 and HeLa cells. A and B , effect of FLNA silencing on TFAP2A mRNA expression was analyzed using the mRNA-Seq data obtained from SaOS2 cell lines expressing control shRNA or FLNA shRNA. TFAP2A mRNA reads from three biological replicates and the log 2 fold change are presented in A and B , respectively. Log 2 fold change was obtained by comparing the mean of TFAP2A mRNA reads from FLNA shRNA samples with that from Ctrl shRNA samples. C and D , effect of FLNA knockdown on TFAP2A expression in SaOS2 cells; RT-qPCR ( C ) and Western blot ( D ) were performed using SaOS2 cells stably expressing control shRNA or FLNA shRNA. E and F , effect of FLNA knockdown on TFAP2A expression in HeLa cells. RT-qPCR ( E ) and Western blot ( F ) were performed using HeLa cell lines stably expressing control shRNA or FLNA shRNA. G and H , effect of FLNA overexpression on TFAP2A expression in HeLa cells. A HeLa cell line stably expressing HA-FLNA and its control cell line (empty vector) were used to extract total RNA. TFAP2A mRNA expression was analyzed by RT-qPCR using the cDNA synthesized from the total RNA ( G ). TFAP2A protein expression was detected by Western blot using the total cell lysate of these cell lines and the antibodies against the factors as indicated ( H ). I , expression of TFAP2A in SaOS2, 293T, and HeLa cells was analyzed by Western blot. Each column in histograms represents the mean ± SD of three biological replicates. ∗ p < 0.05; ∗∗ p < 0.01. p values were obtained by Student’s t test. RT-qPCR, reverse transcription–quantitative polymerase chain reaction.

Article Snippet: The lentiviral expression vectors such as pLV-U6-EGFP-Puro, pLV-U6-mCherry-Puro, and pLV-EF1α-EGFP-Puro were purchased from Inovogen Tech Co. FLNA shRNA lentiviral particles (SC-35374-V) and control shRNA lentiviral particles (SC-108080) were obtained from Santa Cruz Biotech.

Techniques: Expressing, Control, shRNA, Knockdown, Quantitative RT-PCR, Western Blot, Stable Transfection, Over Expression, Plasmid Preparation, Synthesized, Reverse Transcription, Real-time Polymerase Chain Reaction

TFAP2A silencing inhibited the expression of Pol III products. A – C , transient transfection of TFAP2A siRNA decreased the expression of Pol III products in 293T cells. 293T cells transiently transfected with control siRNA or FLNA siRNA were used to analyze TFAP2A expression by RT-qPCR ( A ) and Western blot ( B ). Pol III products were analyzed by RT-qPCR ( C ). D – F , transient transfection of TFAP2A siRNA decreased the expression of Pol III products in HeLa cells. HeLa cells transiently transfected with control siRNA or FLNA siRNA were used to analyze TFAP2A expression by RT-qPCR ( D ) and Western blot ( E ). Pol III products were detected by RT-qPCR ( F ). G – I , TFAP2A shRNA stable expression reduced the expression of Pol III products in 293T cells. 293T cell lines stably expressing control shRNA or FLNA shRNA were used to analyze TFAP2A expression by RT-qPCR ( G ) and Western blot ( H ), where Pol III products were detected by RT-qPCR ( I ). J – L , TFAP2A shRNA stable expression reduced the expression of Pol III products in HeLa cells. HeLa cell lines stably expressing control shRNA or FLNA shRNA were used to analyze TFAP2A expression by RT-qPCR ( J ) and Western blot ( K ), where Pol III products were detected by RT-qPCR ( L ). Each column in histograms represents the mean ± SD of three biological replicates. ∗ p < 0.05; ∗∗ p < 0.01. p Values were obtained by Student’s t test. RT-qPCR, reverse transcription–quantitative polymerase chain reaction.

Journal: The Journal of Biological Chemistry

Article Title: Transcription factor AP-2α activates RNA polymerase III–directed transcription and tumor cell proliferation by controlling expression of c-MYC and p53

doi: 10.1016/j.jbc.2023.102945

Figure Lengend Snippet: TFAP2A silencing inhibited the expression of Pol III products. A – C , transient transfection of TFAP2A siRNA decreased the expression of Pol III products in 293T cells. 293T cells transiently transfected with control siRNA or FLNA siRNA were used to analyze TFAP2A expression by RT-qPCR ( A ) and Western blot ( B ). Pol III products were analyzed by RT-qPCR ( C ). D – F , transient transfection of TFAP2A siRNA decreased the expression of Pol III products in HeLa cells. HeLa cells transiently transfected with control siRNA or FLNA siRNA were used to analyze TFAP2A expression by RT-qPCR ( D ) and Western blot ( E ). Pol III products were detected by RT-qPCR ( F ). G – I , TFAP2A shRNA stable expression reduced the expression of Pol III products in 293T cells. 293T cell lines stably expressing control shRNA or FLNA shRNA were used to analyze TFAP2A expression by RT-qPCR ( G ) and Western blot ( H ), where Pol III products were detected by RT-qPCR ( I ). J – L , TFAP2A shRNA stable expression reduced the expression of Pol III products in HeLa cells. HeLa cell lines stably expressing control shRNA or FLNA shRNA were used to analyze TFAP2A expression by RT-qPCR ( J ) and Western blot ( K ), where Pol III products were detected by RT-qPCR ( L ). Each column in histograms represents the mean ± SD of three biological replicates. ∗ p < 0.05; ∗∗ p < 0.01. p Values were obtained by Student’s t test. RT-qPCR, reverse transcription–quantitative polymerase chain reaction.

Article Snippet: The lentiviral expression vectors such as pLV-U6-EGFP-Puro, pLV-U6-mCherry-Puro, and pLV-EF1α-EGFP-Puro were purchased from Inovogen Tech Co. FLNA shRNA lentiviral particles (SC-35374-V) and control shRNA lentiviral particles (SC-108080) were obtained from Santa Cruz Biotech.

Techniques: Expressing, Transfection, Control, Quantitative RT-PCR, Western Blot, shRNA, Stable Transfection, Reverse Transcription, Real-time Polymerase Chain Reaction

Effect of TFAP2A expression change on cell proliferation activity. A and B , TFAP2A knockdown reduced 293T cell proliferation. The proliferative activity of 293T cells stably expressing control shRNA or TFAP2A shRNA was analyzed by cell counting ( A ) and MTT assays ( B ). C and D , TFAP2A silencing decreased HeLa cell proliferation. The proliferative activity of HeLa cells stably expressing control shRNA or TFAP2A shRNA was analyzed by cell counting ( C ) and MTT assays ( D ). E and F , EdU assay results showing the effect of TFAP2A downregulation on 293T cell growth. The samples of 293T cells from EdU assays were imaged under a fluorescence microscope, and representative images were presented in E . The rate of EdU-positive cells ( F ) was calculated based on the images obtained in multiple samples using ImageJ software. G and H , EdU assay results for HeLa cells stably expressing control shRNA or TFAP2A shRNA. Images ( G ) for EdU-labeled cells were obtained and presented as for E . Scale bars in E and G represent 50 μm. The rate of EdU-positive cells ( H ) was obtained as described in F . I and J , ML-60218 (a Pol III transcription inhibitor) inhibited the activation of proliferative activity and Pol III–directed transcription induced by TFAP2A overexpression. A 293T cell line expressing HA-TFAP2A and its control cell line were cultured and used for the analysis of proliferative activity ( I ) and Pol III products ( J ) in the presence or absence of 54 μM ML-60218. Each column in histograms represents the mean ± SD of three biological replicates. ∗ p < 0.05; ∗∗ p < 0.01. p Values in A – D and I were obtained by two-way ANOVA, while other p values were obtained by Student’s t test.

Journal: The Journal of Biological Chemistry

Article Title: Transcription factor AP-2α activates RNA polymerase III–directed transcription and tumor cell proliferation by controlling expression of c-MYC and p53

doi: 10.1016/j.jbc.2023.102945

Figure Lengend Snippet: Effect of TFAP2A expression change on cell proliferation activity. A and B , TFAP2A knockdown reduced 293T cell proliferation. The proliferative activity of 293T cells stably expressing control shRNA or TFAP2A shRNA was analyzed by cell counting ( A ) and MTT assays ( B ). C and D , TFAP2A silencing decreased HeLa cell proliferation. The proliferative activity of HeLa cells stably expressing control shRNA or TFAP2A shRNA was analyzed by cell counting ( C ) and MTT assays ( D ). E and F , EdU assay results showing the effect of TFAP2A downregulation on 293T cell growth. The samples of 293T cells from EdU assays were imaged under a fluorescence microscope, and representative images were presented in E . The rate of EdU-positive cells ( F ) was calculated based on the images obtained in multiple samples using ImageJ software. G and H , EdU assay results for HeLa cells stably expressing control shRNA or TFAP2A shRNA. Images ( G ) for EdU-labeled cells were obtained and presented as for E . Scale bars in E and G represent 50 μm. The rate of EdU-positive cells ( H ) was obtained as described in F . I and J , ML-60218 (a Pol III transcription inhibitor) inhibited the activation of proliferative activity and Pol III–directed transcription induced by TFAP2A overexpression. A 293T cell line expressing HA-TFAP2A and its control cell line were cultured and used for the analysis of proliferative activity ( I ) and Pol III products ( J ) in the presence or absence of 54 μM ML-60218. Each column in histograms represents the mean ± SD of three biological replicates. ∗ p < 0.05; ∗∗ p < 0.01. p Values in A – D and I were obtained by two-way ANOVA, while other p values were obtained by Student’s t test.

Article Snippet: The lentiviral expression vectors such as pLV-U6-EGFP-Puro, pLV-U6-mCherry-Puro, and pLV-EF1α-EGFP-Puro were purchased from Inovogen Tech Co. FLNA shRNA lentiviral particles (SC-35374-V) and control shRNA lentiviral particles (SC-108080) were obtained from Santa Cruz Biotech.

Techniques: Expressing, Activity Assay, Knockdown, Stable Transfection, Control, shRNA, Cell Counting, EdU Assay, Fluorescence, Microscopy, Software, Labeling, Activation Assay, Over Expression, Cell Culture

TFAP2A regulates the recruitment of the Pol III transcription machinery components to Pol III target loci and the expression of Pol III transcription-related proteins. A – D , TFAP2A silencing inhibited the recruitment of the Pol III transcription machinery components at Pol III target loci. ChIP assays were performed using HeLa cell lines stably expressing control shRNA or TFAP2A shRNA and antibodies against the factors as indicated. Relative enrichment was obtained by comparing the DNA quantity of a gene locus from 1 μl of ChIP DNA samples (1/40 of ChIP DNA) with that from 0.05% input DNA (1 ng genomic DNA). E and F , TFAP2A downregulation inhibited BRF1 and GTF3C2 expression. Western blot was performed using 293T ( E ) and HeLa ( F ) cell lines stably expressing control shRNA or TFAP2A shRNA and antibodies against the indicated factors. Bottom panels in E and F represent the quantified results of Western blots in the corresponding upper panels . GAPDH c :GAPDH for control group. G and H , TFAP2A overexpression enhanced BRF1 and GTF3C2 expression. Western blot was performed using 293T ( G ) and HeLa ( H ) cell lines stably expressing HA-TFAP2A and their control cell lines and antibodies against the indicated factors. Bottom panels in G and H represent the quantified results of Western blots in the corresponding upper panels . GAPDH c :GAPDH for control group. I and J , TFAP2A depletion reduced MDM2 and c-MYC expression but increased p53 expression in 293T cells. Western blot was performed as described in E . J , represents the quantified results of Western blots in I. K and L , TFAP2A overexpression activated MDM2 and c-MYC proteins but inhibited p53 protein expression in 293T cells. Western blot was performed as described in G . L , represents the quantified results of Western blots in K . Each column in histograms represents the mean ± SD of three biological replicates. ∗ p < 0.05; ∗∗ p < 0.01. p Values were obtained by Student’s t test.

Journal: The Journal of Biological Chemistry

Article Title: Transcription factor AP-2α activates RNA polymerase III–directed transcription and tumor cell proliferation by controlling expression of c-MYC and p53

doi: 10.1016/j.jbc.2023.102945

Figure Lengend Snippet: TFAP2A regulates the recruitment of the Pol III transcription machinery components to Pol III target loci and the expression of Pol III transcription-related proteins. A – D , TFAP2A silencing inhibited the recruitment of the Pol III transcription machinery components at Pol III target loci. ChIP assays were performed using HeLa cell lines stably expressing control shRNA or TFAP2A shRNA and antibodies against the factors as indicated. Relative enrichment was obtained by comparing the DNA quantity of a gene locus from 1 μl of ChIP DNA samples (1/40 of ChIP DNA) with that from 0.05% input DNA (1 ng genomic DNA). E and F , TFAP2A downregulation inhibited BRF1 and GTF3C2 expression. Western blot was performed using 293T ( E ) and HeLa ( F ) cell lines stably expressing control shRNA or TFAP2A shRNA and antibodies against the indicated factors. Bottom panels in E and F represent the quantified results of Western blots in the corresponding upper panels . GAPDH c :GAPDH for control group. G and H , TFAP2A overexpression enhanced BRF1 and GTF3C2 expression. Western blot was performed using 293T ( G ) and HeLa ( H ) cell lines stably expressing HA-TFAP2A and their control cell lines and antibodies against the indicated factors. Bottom panels in G and H represent the quantified results of Western blots in the corresponding upper panels . GAPDH c :GAPDH for control group. I and J , TFAP2A depletion reduced MDM2 and c-MYC expression but increased p53 expression in 293T cells. Western blot was performed as described in E . J , represents the quantified results of Western blots in I. K and L , TFAP2A overexpression activated MDM2 and c-MYC proteins but inhibited p53 protein expression in 293T cells. Western blot was performed as described in G . L , represents the quantified results of Western blots in K . Each column in histograms represents the mean ± SD of three biological replicates. ∗ p < 0.05; ∗∗ p < 0.01. p Values were obtained by Student’s t test.

Article Snippet: The lentiviral expression vectors such as pLV-U6-EGFP-Puro, pLV-U6-mCherry-Puro, and pLV-EF1α-EGFP-Puro were purchased from Inovogen Tech Co. FLNA shRNA lentiviral particles (SC-35374-V) and control shRNA lentiviral particles (SC-108080) were obtained from Santa Cruz Biotech.

Techniques: Expressing, Stable Transfection, Control, shRNA, Western Blot, Over Expression

TFAP2A activates Brf1 and Gtf3c2 gene transcription by binding to their promoters. A and B , TFAP2A knockdown reduced the expression of BRF1 and GTF3C2 mRNA. 293T ( A ) and HeLa ( B ) cell lines stably expressing control shRNA or TFAP2A shRNA were used to analyze the expression of BRF1 and GTF3C2 mRNA by RT-qPCR. C and D , TFAP2A overexpression enhanced the expression of BRF1 and GTF3C2 mRNA. 293T ( C ) and HeLa ( D ) cell lines stably expressing HA-TFAP2A and the corresponding control cell lines were used to analyze the expression of BRF1 and GTF3C2 mRNA by RT-qPCR. E , A diagram showing the location of TFAP2A-binding sites at the Brf1 promoter 4 ( Brf1 P4) and Gtf3c2 promoter 2 ( Gtf3c2 P2). The red area within the promoters represents a TFAP2A consensus sequence: GCC(N)3/4GGC/G). FP and RP represent primers used for ChIP-qPCR. FP, forward primer; RP, reverse primer. F and G , TFAP2A binds to Brf1 P4 and G tf3c2 P2. ChIP assays were performed using HeLa cells and the anti-TFAP2A antibody and control IgG. The DNA quantity of Brf1 P4 ( F ) and G tf3c2 P2 ( G ) was monitored by qPCR. The relative enrichment was obtained as described in <xref ref-type=Fig. 4 , A – D . H and I , TFAP2A depletion by shRNA expression inhibited the activities of Brf1 P4 and G tf3c2 P2. Reporter assays were performed by transfecting the Brf1 P4- or G tf3c2 P2-driven reporter vectors into 293T ( H ) and HeLa ( I ) cell lines expressing control shRNA or TFAP2A shRNA. Relative luciferase activity (Rel luc act) was obtained by comparing the luciferase activity of treated samples (TFAP2A shRNA) with that of control samples (Ctrl shRNA), where the luciferase activity of the control samples was arbitrarily set as 1. J , TFAP2A overexpression activated the activities of Brf1 P4 and G tf3c2 P2 in 293T cells. Luciferase assays were performed by transfecting the Brf1 P4- or G tf3c2 P2-driven reporter vectors into the 293T cell line expressing HA-TFAP2A and the corresponding control cell line. K , a scheme showing the wildtype DNA fragment of Brf1 P4 and Gtf3C2 P2 and their mutants containing mutated TFAP2A consensus bases. The bold blue bases within the promoter sequences represent wildtype TFAP2A consensus sequence, whereas the bold red bases represent mutated TFAP2A consensus bases (mut). L , mutations of TFAP2A consensus sequence severely affected the activities of Brf1 P4 and G tf3c2 P2 in 293T cells. Luciferase assays were performed by transfecting 293T cells with the reporter vectors driven by the wildtype promoters ( Brf1 P4 and G tf3c2 P2) or by their mutants. The relative luciferase activity (Rel luc act) was obtained as described in H . BSM, binding site mutations. Each column in histograms represents the mean ± SD of three biological replicates. ∗ p < 0.05; ∗∗ p < 0.01. p Values were obtained by Student’s t test. ChIP, chromatin immunoprecipitation; RT-qPCR, reverse transcription–quantitative polymerase chain reaction. " width="100%" height="100%">

Journal: The Journal of Biological Chemistry

Article Title: Transcription factor AP-2α activates RNA polymerase III–directed transcription and tumor cell proliferation by controlling expression of c-MYC and p53

doi: 10.1016/j.jbc.2023.102945

Figure Lengend Snippet: TFAP2A activates Brf1 and Gtf3c2 gene transcription by binding to their promoters. A and B , TFAP2A knockdown reduced the expression of BRF1 and GTF3C2 mRNA. 293T ( A ) and HeLa ( B ) cell lines stably expressing control shRNA or TFAP2A shRNA were used to analyze the expression of BRF1 and GTF3C2 mRNA by RT-qPCR. C and D , TFAP2A overexpression enhanced the expression of BRF1 and GTF3C2 mRNA. 293T ( C ) and HeLa ( D ) cell lines stably expressing HA-TFAP2A and the corresponding control cell lines were used to analyze the expression of BRF1 and GTF3C2 mRNA by RT-qPCR. E , A diagram showing the location of TFAP2A-binding sites at the Brf1 promoter 4 ( Brf1 P4) and Gtf3c2 promoter 2 ( Gtf3c2 P2). The red area within the promoters represents a TFAP2A consensus sequence: GCC(N)3/4GGC/G). FP and RP represent primers used for ChIP-qPCR. FP, forward primer; RP, reverse primer. F and G , TFAP2A binds to Brf1 P4 and G tf3c2 P2. ChIP assays were performed using HeLa cells and the anti-TFAP2A antibody and control IgG. The DNA quantity of Brf1 P4 ( F ) and G tf3c2 P2 ( G ) was monitored by qPCR. The relative enrichment was obtained as described in Fig. 4 , A – D . H and I , TFAP2A depletion by shRNA expression inhibited the activities of Brf1 P4 and G tf3c2 P2. Reporter assays were performed by transfecting the Brf1 P4- or G tf3c2 P2-driven reporter vectors into 293T ( H ) and HeLa ( I ) cell lines expressing control shRNA or TFAP2A shRNA. Relative luciferase activity (Rel luc act) was obtained by comparing the luciferase activity of treated samples (TFAP2A shRNA) with that of control samples (Ctrl shRNA), where the luciferase activity of the control samples was arbitrarily set as 1. J , TFAP2A overexpression activated the activities of Brf1 P4 and G tf3c2 P2 in 293T cells. Luciferase assays were performed by transfecting the Brf1 P4- or G tf3c2 P2-driven reporter vectors into the 293T cell line expressing HA-TFAP2A and the corresponding control cell line. K , a scheme showing the wildtype DNA fragment of Brf1 P4 and Gtf3C2 P2 and their mutants containing mutated TFAP2A consensus bases. The bold blue bases within the promoter sequences represent wildtype TFAP2A consensus sequence, whereas the bold red bases represent mutated TFAP2A consensus bases (mut). L , mutations of TFAP2A consensus sequence severely affected the activities of Brf1 P4 and G tf3c2 P2 in 293T cells. Luciferase assays were performed by transfecting 293T cells with the reporter vectors driven by the wildtype promoters ( Brf1 P4 and G tf3c2 P2) or by their mutants. The relative luciferase activity (Rel luc act) was obtained as described in H . BSM, binding site mutations. Each column in histograms represents the mean ± SD of three biological replicates. ∗ p < 0.05; ∗∗ p < 0.01. p Values were obtained by Student’s t test. ChIP, chromatin immunoprecipitation; RT-qPCR, reverse transcription–quantitative polymerase chain reaction.

Article Snippet: The lentiviral expression vectors such as pLV-U6-EGFP-Puro, pLV-U6-mCherry-Puro, and pLV-EF1α-EGFP-Puro were purchased from Inovogen Tech Co. FLNA shRNA lentiviral particles (SC-35374-V) and control shRNA lentiviral particles (SC-108080) were obtained from Santa Cruz Biotech.

Techniques: Binding Assay, Knockdown, Expressing, Stable Transfection, Control, shRNA, Quantitative RT-PCR, Over Expression, Sequencing, ChIP-qPCR, Luciferase, Activity Assay, Chromatin Immunoprecipitation, Reverse Transcription, Real-time Polymerase Chain Reaction

TFAP2A can modulate Pol III–directed transcription by affecting the activity of the MDM2-p53 pathway. A , Western blot results showing the generation of HeLa cell lines expressing both TFAP2A shRNA and mCherry-MDM2. B , expression of mCherry-MDM2 reversed the inhibition of Pol III–directed transcription induced by TFAP2A silencing in HeLa cell lines. RT-qPCR was performed using the cell lines established in A . C , expression of mCherry-MDM2 reversed the inhibition of HeLa cell proliferation caused by TFAP2A silencing. D and E , RT-qPCR results showing the effect of TFAP2A silencing ( D ) and overexpression ( E ) on MDM2 mRNA expression in HeLa cells. F , diagram showing the locations of two TFAP2A consensus sequences ( bold blue letters ) at the MDM2 promoter 1 and its mutant containing mutated TFAP2A sites ( bold red letters ) in the TFAP2A consensus sequences. G , TFAP2A binds to the MDM2 promoter 1 in HeLa cells. Chromatin immunoprecipitation assays were performed using HeLa cells and an anti-TRFAP2A antibody or control IgG. H and I , TFAP2A activates the MDM2 P1 activity in HeLa cells. Luciferase assays were performed by transfecting the MDM2 P1-driven reporter vectors into HeLa cell lines under TFAP2A silencing ( H ) or overexpression ( I ) and the corresponding cell lines. Luciferase activity for controls or treatments was normalized by the protein quantity used in the assays. J , mutations of TFAP2A-binding sites dampened the MDMP1 activity in HeLa cells. Luciferase assays were performed as for H and I . Mut (all) represents the mutant containing mutations of all TFAP2A-binding sites. K and L , expression of mCherry-MDM2 inhibited the activation of p53 expression induced by TFAP2A silencing. Western blot was performed using the cell lines generated in A and antibodies against the indicated factors. L , represents the quantified result of the blots in K . GAPDH c :GAPDH for control group. Each column in histograms represents the mean ± SD of three biological replicates. ∗ p < 0.05; ∗∗ p < 0.01. p Values in C were obtained by two-way ANOVA, whereas p values in other graphs were obtained by Student’s t test. RT-qPCR, reverse transcription–quantitative polymerase chain reaction.

Journal: The Journal of Biological Chemistry

Article Title: Transcription factor AP-2α activates RNA polymerase III–directed transcription and tumor cell proliferation by controlling expression of c-MYC and p53

doi: 10.1016/j.jbc.2023.102945

Figure Lengend Snippet: TFAP2A can modulate Pol III–directed transcription by affecting the activity of the MDM2-p53 pathway. A , Western blot results showing the generation of HeLa cell lines expressing both TFAP2A shRNA and mCherry-MDM2. B , expression of mCherry-MDM2 reversed the inhibition of Pol III–directed transcription induced by TFAP2A silencing in HeLa cell lines. RT-qPCR was performed using the cell lines established in A . C , expression of mCherry-MDM2 reversed the inhibition of HeLa cell proliferation caused by TFAP2A silencing. D and E , RT-qPCR results showing the effect of TFAP2A silencing ( D ) and overexpression ( E ) on MDM2 mRNA expression in HeLa cells. F , diagram showing the locations of two TFAP2A consensus sequences ( bold blue letters ) at the MDM2 promoter 1 and its mutant containing mutated TFAP2A sites ( bold red letters ) in the TFAP2A consensus sequences. G , TFAP2A binds to the MDM2 promoter 1 in HeLa cells. Chromatin immunoprecipitation assays were performed using HeLa cells and an anti-TRFAP2A antibody or control IgG. H and I , TFAP2A activates the MDM2 P1 activity in HeLa cells. Luciferase assays were performed by transfecting the MDM2 P1-driven reporter vectors into HeLa cell lines under TFAP2A silencing ( H ) or overexpression ( I ) and the corresponding cell lines. Luciferase activity for controls or treatments was normalized by the protein quantity used in the assays. J , mutations of TFAP2A-binding sites dampened the MDMP1 activity in HeLa cells. Luciferase assays were performed as for H and I . Mut (all) represents the mutant containing mutations of all TFAP2A-binding sites. K and L , expression of mCherry-MDM2 inhibited the activation of p53 expression induced by TFAP2A silencing. Western blot was performed using the cell lines generated in A and antibodies against the indicated factors. L , represents the quantified result of the blots in K . GAPDH c :GAPDH for control group. Each column in histograms represents the mean ± SD of three biological replicates. ∗ p < 0.05; ∗∗ p < 0.01. p Values in C were obtained by two-way ANOVA, whereas p values in other graphs were obtained by Student’s t test. RT-qPCR, reverse transcription–quantitative polymerase chain reaction.

Article Snippet: The lentiviral expression vectors such as pLV-U6-EGFP-Puro, pLV-U6-mCherry-Puro, and pLV-EF1α-EGFP-Puro were purchased from Inovogen Tech Co. FLNA shRNA lentiviral particles (SC-35374-V) and control shRNA lentiviral particles (SC-108080) were obtained from Santa Cruz Biotech.

Techniques: Activity Assay, Western Blot, Expressing, shRNA, Inhibition, Quantitative RT-PCR, Over Expression, Mutagenesis, Chromatin Immunoprecipitation, Control, Luciferase, Binding Assay, Activation Assay, Generated, Reverse Transcription, Real-time Polymerase Chain Reaction

TFAP2A is required for the activation of Pol III–directed transcription induced by FLNA silencing. A and B , generation of SaOS2 cell lines expressing both FLNA shRNA and TFAP2A shRNA. TFAP2A expression in the cell lines as indicated was analyzed by RT-qPCR ( A ) and Western blot ( B ). C , TFAP2A depletion inhibited the activation of Pol III–directed transcription induced by FLNA silencing in SaOS2 cells. Pol III products were analyzed by RT-qPCR. D and E , TFAP2A depletion inhibited the enhancement of SaOS2 cell proliferation induced by FLNA silencing in SaOS2 cells. Cell counting ( D ) and MTT ( E ) assays were performed using cell lines established in A and B and the corresponding control cell line. F , BRF1 and GTF3C2 expression in SaOS2 cell lines was detected by RT-qPCR. G , BRF1 and GTF3C2 expression in SaOS2 cell lines was detected by Western blot. H , a proposed model showing the regulatory mechanisms by which TFAP2A modulates Pol III–directed transcription. Each column in histograms represents the mean ± SD of three biological replicates. ∗ p < 0.05; ∗∗ p < 0.01. p Values were obtained by Student’s t test. RT-qPCR, reverse transcription–quantitative polymerase chain reaction.

Journal: The Journal of Biological Chemistry

Article Title: Transcription factor AP-2α activates RNA polymerase III–directed transcription and tumor cell proliferation by controlling expression of c-MYC and p53

doi: 10.1016/j.jbc.2023.102945

Figure Lengend Snippet: TFAP2A is required for the activation of Pol III–directed transcription induced by FLNA silencing. A and B , generation of SaOS2 cell lines expressing both FLNA shRNA and TFAP2A shRNA. TFAP2A expression in the cell lines as indicated was analyzed by RT-qPCR ( A ) and Western blot ( B ). C , TFAP2A depletion inhibited the activation of Pol III–directed transcription induced by FLNA silencing in SaOS2 cells. Pol III products were analyzed by RT-qPCR. D and E , TFAP2A depletion inhibited the enhancement of SaOS2 cell proliferation induced by FLNA silencing in SaOS2 cells. Cell counting ( D ) and MTT ( E ) assays were performed using cell lines established in A and B and the corresponding control cell line. F , BRF1 and GTF3C2 expression in SaOS2 cell lines was detected by RT-qPCR. G , BRF1 and GTF3C2 expression in SaOS2 cell lines was detected by Western blot. H , a proposed model showing the regulatory mechanisms by which TFAP2A modulates Pol III–directed transcription. Each column in histograms represents the mean ± SD of three biological replicates. ∗ p < 0.05; ∗∗ p < 0.01. p Values were obtained by Student’s t test. RT-qPCR, reverse transcription–quantitative polymerase chain reaction.

Article Snippet: The lentiviral expression vectors such as pLV-U6-EGFP-Puro, pLV-U6-mCherry-Puro, and pLV-EF1α-EGFP-Puro were purchased from Inovogen Tech Co. FLNA shRNA lentiviral particles (SC-35374-V) and control shRNA lentiviral particles (SC-108080) were obtained from Santa Cruz Biotech.

Techniques: Activation Assay, Expressing, shRNA, Quantitative RT-PCR, Western Blot, Cell Counting, Control, Reverse Transcription, Real-time Polymerase Chain Reaction